Como os marcadores polimórficos contribuem para as doenças genéticas em diferentes populações? O estudo da inibina A para insuficiência ovariana prematura

Como os marcadores polimórficos contribuem para as doenças genéticas em diferentes populações? O estudo da inibina A para insuficiência ovariana prematura

Autores:

Denise Maria Christofolini,
Emerson Barchi Cordts,
Fernando Santos-Pinheiro,
Erika Azuma Kayaki,
Mayla Cristina Fernandes Dornas,
Monise de Castro Santos,
Bianca Bianco,
Caio Parente Barbosa

ARTIGO ORIGINAL

Einstein (São Paulo)

versão impressa ISSN 1679-4508versão On-line ISSN 2317-6385

Einstein (São Paulo) vol.15 no.3 São Paulo jul./set. 2017

http://dx.doi.org/10.1590/s1679-45082017ao4052

INTRODUÇÃO

A falência ovariana prematura (FOP), que recentemente passou a se chamar insuficiência ovariana prematura (IOP), é um processo no qual o declínio gradual da função ovariana resulta em falência da foliculogênese antes dos 40 anos de idade. Caracteriza-se pela ausência de menstruação por um período superior a 4 meses (amenorreia secundária), mas pode se manifestar antes da menarca, levando à amenorreia.(1) Em 2015, as diretrizes da European Society of Human Reproduction and Embryology (ESHRE) definiram como critério para a IOP a observação de duas dosagens de hormônio folículo-estimulante (FSH - follicle stimulanting hormone) superiores a 25UI (unidades internacionais), feitas em um intervalo de 4 semanas.

A incidência de IOP em pacientes com cariótipo 46, XX é de 1:1.000 até os 30 anos de idade, 1:250 aos 35 anos e 1:100 aos 40 anos.(2) A prevalência da IOP em pacientes com amenorreia primária é de 10 a 28% e de 4 a 18% naquelas com amenorreia secundária.(3,4) As causas da IOP englobam um amplo espectro que vai desde doenças autoimunes até condições iatrogênicas, mas a forma esporádica da IOP é a mais comum.(5) Em cerca de 5% dos casos, há história familiar positiva, o que sugere predisposição genética à doença.(6)

Embora representem apenas uma pequena fração dos casos, as anomalias do cromossomo X (13%), a autoimunidade (30-40%) e a pré-mutação do gene fragile X mental retardation 1 (FMR1) (6%) foram associadas à IOP.(7) Ainda, a literatura descreve polimorfismos e mutações em vários genes relacionados com a forma esporádica da IOP, inclusive o gene do receptor do hormônio folículo estimulante (FSHR), o gene do receptor do hormônio luteinizante (LHR) e o gene da inibina alfa (INHA).(8-14)

Shelling et al.,(15) estabeleceram a primeira evidência de um vínculo genético entre a inibina e a IOP, por análise citogenética de uma paciente com IOP que tinha o cariótipo 46,XX,t(2;15)(q32.3;q13.3). O gene da INHA localizava-se em 2q33-36, e este rearranjo forneceu uma pista de que a inibina poderia desempenhar um papel no desenvolvimento da IOP.

As inibinas são glicoproteínas diméricas predominantemente produzidas nas gônadas.(16) Elas atuam regulando a secreção de FSH no ciclo menstrual normal, processo este que permite a ovulação de um único folículo maduro.(17) As subunidades da inibina são codificadas por três genes separados: INHA, inibina beta A (INHBA) e inibina beta B (INHBB), que foram mapeadas em 2q33-qter, 2cen-q13 e 7p15-p14, respectivamente.

Estudos anteriores(15,18) sugerem o envolvimento da inibina A na etiologia da IOP, uma vez que defeitos na secreção da inibina podem causar aumento na concentração de FSH, recrutamento de folículos, alteração e depleção prematura do pool de folículos.(15) A análise funcional in vitro(19) forneceu evidência de que a variante G769A pode aumentar a suscetibilidade à IOP com deficiência da bioatividade da INHBB.

OBJETIVO

Verificar a incidência da mutação G679A no éxon 2 do gene da inibina A (INHA) em mulheres com amenorreia secundária diagnosticadas com insuficiência ovariana prematura idiopática e em controles.

MÉTODOS

Setenta pacientes diagnosticadas com IOP foram recrutadas no Centro de Reprodução Humana e Genética da Faculdade de Medicina do ABC, Santo André, São Paulo, de janeiro de 2008 a julho de 2016. Elas foram submetidas à anamnese e à avaliação ginecológica detalhadas. Os critérios clínicos para a IOP estavam de acordo com as diretrizes da ESHRE de 2015. Um fato importante da anamnese dessas mulheres com IOP foi a queixa de infertilidade. Como critério de inclusão, todas as pacientes apresentavam cariótipo normal.

O Grupo Controle incluía 97 mulheres saudáveis que entraram na menopausa fisiológica após os 48 anos de idade, férteis, com histórico menstrual normal, menstruações regulares (duração de 25 a 35 dias), sem histórico pessoal ou familiar de menopausa prematura ou precoce, e sem consumo de contraceptivos orais ou outros medicamentos hormonais no momento do recrutamento. A participação foi voluntária, e todas as mulheres assinaram um Termo de Consentimento esclarecido aprovado pelo Comitê de Ética da Faculdade de Medicina do ABC, sob o número de protocolo 184/2007.

Todas as pacientes foram submetidas a um exame clínico completo, com anamnese médica e ginecológica completas, incluindo a saúde reprodutiva da mãe da paciente, histórico familiar, consanguinidade e outras condições genéticas existentes na família, idade da menarca e idade da menopausa.

Foi coletada uma amostra de 5mL de sangue periférico das participantes do estudo em tubo EDTA para extração de DNA, utilizando-se o kit GE Spin Blood Mini Kit genomic Prep.

As pacientes e os controles foram primeiramente submetidos ao polimorfismo no comprimento de fragmentos de restrição obtido após amplificação da reação em cadeia da polimerase (RFLP-PCR). As reações foram realizadas de acordo com Jeong et al.,(20) com 100ng de DNA, iniciadores (5nM; forward: 5’GGCCCACACTCG- GACCAGAC3’; reverse: 5’ AGCCCACAACCACCAT- GACAGTAG 3’), 10% de tampão para PCR, 50nmol de desoxinucleotídeos trifosfato (dNTPs) e 1 unidade (U) de Taq DNA polimerase em um volume final de 50mL. As condições da PCR foram: desnaturação a 94°C por 5 minutos, 30 ciclos (45 segundos a 94°C; 45 segundos a 65°C; e 1 minuto a 72°C) e extensão de 10 minutos a 72°C. Para a digestão enzimática, foram utilizados 8ul da amostra, 2U da enzima de restrição BbvI, tampão (1x) e água esterilizada. A mistura foi incubada a 37°C por 3 horas e inativada a 65°C por 20 minutos, sendo, então, submetida à eletroforese em gel de agarose a 3%. Após a digestão, o alelo mutante apresentou fragmento com 203 pares de bases (pb), e o alelo normal apresentou dois fragmentos, um com 85 e outro com 159 pb. O heterozigoto apresentou três fragmentos: 203, 159 e 85 pb.

Após a análise RFLP, decidimos realizar o sequenciamento Sanger dos éxons codantes 2 e 3 do gene INHA. Eles foram amplificados por PCR, a partir de 100ng de amostra de DNA na presença de 5nmol de cada primer (iniciador; forward: 5’ GCCCACACTCGGACCAGAC 3’; reverse 5’ CGTGAGAAGGTTGGGCACTG 3’), purificados com o kit STRATEC e preparados para sequenciamento utilizando-se o BigDye® Terminator v3.1 Cycle Sequencing Kit, de acordo com o protocolo do fabricante (AppliedBiosystems, Foster City, CA, EUA). O sequenciamento foi realizado em um ABI 3500 GeneticAnalyzer, e os resultados foram avaliados pelos programas SeqA e VariantReporter. A análise estatística foi realizada com o programa Stata 11. O teste exato de Fisher foi realizado para comparar a incidência de genótipos e alelos entre as amostras dos grupos IOP e controle.

RESULTADOS

Foram investigadas 70 mulheres com IOP idiopática confirmada, com média de idade 36,0 anos (±7,49 anos). Levando em consideração o Grupo Controle, a média de idade foi 48 anos. A média de idade do último período menstrual nas pacientes com IOP foi 31,5 anos (±6,59 anos). Os sintomas mais comumente relatados nas consultas médicas foram fogachos, infertilidade, diminuição da libido e atrofia do trato geniturinário. A dosagem média de FSH foi de 64,3mIU/mL. De acordo com o RFLP-PCR e a análise sequencial das amostras, somente uma paciente mostrou-se heterozigota para a mutação G769A (Tabela 1).

Tabela 1 Genótipo e distribuição alélica do polimorfismo G769A do gene INHA em pacientes brasileiras com insuficiência ovariana prematura e em controles 

Grupo Genótipos Distribuição alélica


GG GA AA Valor de p G A Valor de p
IOP 69 1* 0 0,416 139 1 0,419
Controle 97 0 0 194 0

* A frequência do alelo A em nossa amostra brasileira foi de 0,003.

IOP: insuficiência ovariana prematura.

DISCUSSÃO

A produção deficiente de inibina foi associada à menopausa natural e ao desenvolvimento da IOP. Níveis elevados de inibina A encontrados em mulheres com IOP são semelhantes aos observados nas mulheres pós-menopausadas.(21) Vários estudos sugerem que a diminuição dos níveis de inibina nas mulheres em período perimenopáusico, associada ao aumento concomitante da dosagem de ativina A, pode ser responsável pela dosagem elevada de FSH, que é característica do envelhecimento da função reprodutiva. Embora a redução do índice inibina/ativina observado durante a menopausa provavelmente ocorra devido à síntese deficiente de inibina,(22) a falência ovariana pode ser considerada resultado das mutações no gene INHA, que causariam a diminuição da concentração da inibina e, consequentemente, o aumento nos níveis de FSH.

A presença da substituição G769A no éxon 2 do gene INHA foi estudada pela primeira vez por Shelling et al.,(15) em 3 de 43 mulheres com IOP, em comparação com um de 150 controles. Mais tarde, Marozzi et al.,(18) relataram que a transição G769A era significativamente mais frequente em pacientes com IOP (7 de 157) do que no Grupo Controle (zero de 100). A hipótese levantada é a de que esta substituição prejudicaria a afinidade da inibina por seu receptor.(15) Essa mutação também foi detectada em 9 de 80 pacientes com IOP, e em nenhum de 100 controles na Índia.(23) Prakash et al.,(24) encontraram esta mutação em 13 de 100 mulheres hindus com IOP e em 2 de 50 controles. Também encontraram três novas variantes do gene INHA em uma paciente com IOP. No entanto, um estudo coreano não demonstrou a substituição G769A em nenhuma de um grupo de 84 pacientes com IOP nem em 100 controles.(20) Além do mais, o significado funcional do aminoácido variante do códon 257 ainda é desconhecido, pois nenhum estudo funcional foi realizado até agora. Outro estudo sobre a transição G769A foi realizado por Sundblad et al.,(25) na Argentina, e também não encontrou nenhuma associação entre a mutação G769A e a IOP, na avaliação de 59 pacientes e 73 controles.

Outras mutações do gene INHA também foram associadas à IOP. Os estudos de Harris et al.,(26) Woad et al.,(27) e Dixit et al.,(28) com populações da Nova Zelândia, Eslovênia e Índia, observaram diferenças significativas da frequência alélica na região promotora do gene INHA entre os grupos IOP e controle, concluindo que estas variações tinham relação com a manifestação da IOP. Para tentar esclarecer um pouco os resultados contraditórios da associação entre os polimorfismos do gene INHA e a IOP, Zintzaras et al.,(29) realizaram metanálise das mutações INHA G769A, C16T, A124G e sua associação à IOP. Levando em consideração os dados cumulativos, nenhuma das mutações mostrou estar associada à IOP. Somente houve indício de associação à mutação INHA G769A em indianas asiáticas.

O presente estudo avaliou um grupo de 70 mulheres com IOP e um Grupo Controle composto de 97 mulheres com mais de 40 anos e com ciclos menstruais normais. A substituição G769A no éxon 2 do gene INHA foi encontrada em uma paciente, e em nenhuma do Grupo Controle (frequência alélica de 0,003). Nenhuma diferença estatística foi observada entre os grupos. Este resultado confirma o que foi observado nos estudos de Sundblad et al.,(25) e de Jeong et al.,(20) e sugere que a alteração G769A seja incomum em mulheres brasileiras com IOP.

Uma limitação do presente estudo foi o tamanho da amostra. Isso aconteceu devido à raridade da percepção do evento, uma vez que muitas mulheres em idade reprodutiva utilizam contraceptivos orais que “mascaram” as menstruações irregulares. Além disto, nossa amostra foi rigorosamente selecionada, estando livre de cariótipos anormais e pré-mutação do gene FMR1. A amostra também é maior do que a da maioria dos artigos publicados sobre IOP. A despeito desta limitação, este estudo fornece evidências de heterogeneidade genética no gene INHA em diferentes populações e na etiologia da IOP.

A insuficiência ovariana prematura é uma doença complexa, determinada por interações entre fatores genéticos e ambientais, e seria de grande interesse caracterizar a real relação entre as inibinas e a IOP em grande número de casos.

CONCLUSÃO

O estudo mostrou que há heterogeneidade genética relacionada ao gene INHA em diferentes populações e em meio às causas da insuficiência ovariana prematura.

REFERÊNCIAS

1. Santoro N. Mechanisms of premature ovarian failure. Ann Endocrinol (Paris). 2003;64(2):87-92. Review.
2. Vilodre LC, Moretto M, Kohek MB, Spritzer PM. [Premature ovarian failure: present aspects]. Arq Bras Endocrinol Metabol. 2007;51(6):920-9. Review.Portuguese.
3. Anasti JN. Premature ovarian failure: an update. Fertil Steril. 1998;70(1):1-15. Review.
4. van Kasteren YM, Schoemaker J. Premature ovarian failure: a systematic review on therapeutic interventions to restore ovarian function and achieve pregnancy. Hum Reprod Update. 1999;5(5):483-92. Review.
5. Beck-Peccoz P, Persani L. Premature ovarian failure. Orphanet J Rare Dis. 2006;1:9. Review.
6. Goswami D, Conway GS. Premature ovarian failure. Hum Reprod Update. 2005;11(4):391-410. Review.
7. Conway GS, Kaltsas G, Patel A, Davies MC, Jacobs HS. Characterization of idiopathic premature ovarian failure. Fertil Steril. 1996;65(2):337-41.
8. Aittomäki K, Lucena JL, Pakarinen P, Sistonen P, Tapanainen J, Gromoll J, et al. Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell. 1995;82(6):959-68.
9. Beau I, Touraine P, Meduri G, Gougeon A, Desroches A, Matuchansky C, et al. A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor. J Clin Invest. 1998;102(7):1352-9.
10. Achermann JC, Ozisik G, Meeks JJ, Jameson JL. Genetic causes of human reproductive diseases. J Clin Endocrinol Metab. 2002;87(6):2447-54. Review.
11. Simoni M, Nieschlag E, Gromoll J. Isoforms and single nucleotide polymorphisms of the FSH receptor gene: implications for human reproduction. Hum Reprod Update. 2002;8(5):413-21. Review.
12. De Baere E, Beysen D, Oley C, Lorenz B, Cocquet J, De Sutter P, et al. FOXL2 and BPES: mutational hotspots, phenotypic variability, and revision of the genotype-phenotype correlation. Am J Hum Genet. 2003;72(2):478-87.
13. Di Pasquale E, Beck-Peccoz P, Persani L. Hypergonadotropic ovarian failure associated with an inherited mutation of human bone morphogenetic protein-15 (BMP15) gene. Am J Hum Genet. 2004;75(1):106-11.
14. Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic protein system in mammalian reproduction. Endocr Rev. 2004;25(1):72-101. Review.
15. Shelling AN, Burton KA, Chand AL, van Ee CC, France JT, Farquhar CM, et al. Inhibin: a candidate gene for premature ovarian failure. Hum Reprod. 2000; 15(12):2644-9.
16. Burger HG. Inhibin. Reprod Med Rev. 1992;1:1-20.
17. Ying SY. Inhibins, activins, and follistatins: gonadal proteins modulating the secretion of follicle-stimulating hormone. Endocr Rev. 1988;9(2):267-93. Review.
18. Marozzi A, Porta C, Vegetti W, Crosignani PG, Tibiletti MG, Dalprà L, et al. Mutation analysis of the inhibin alpha gene in a cohort of Italian women affected by ovarian failure. Hum Reprod. 2002;17(7):1741-5.
19. Chand AL, Ooi GT, Harrison CA, Shelling AN, Robertson DM. Functional analysis of the human inhibin alpha subunit variant A257T and its potential role in premature ovarian failure. Hum Reprod. 2007;22(12):3241-8.
20. Jeong HJ, Cho SW, Kim HA, Lee SH, Cho JH, Choi DH, et al. G769A variation of inhibin alpha-gene in korean women with premature ovarian failure. Yonsei Med J. 2004;45(3):479-82.
21. Luisi S, Florio P, Reis FM, Petraglia F. Inhibins in female and male reproductive physiology: role in gametogenesis, conception, implantation and early pregnancy. Human Reprod Update. 2005;11(2):123-35. Review.
22. Santoro N, Adel T, Skurnick JH. Decreased inhibin tone and increased activin A secretion characterize reproductive aging in women. Fertil Steril. 1999; 71(4):658-62.
23. Dixit H, Deendayal M, Singh L. Mutational analysis of the mature peptide region of inhibin genes in Indian women with ovarian failure. Hum Reprod. 2004;19(8):1760-4.
24. Prakash GJ, Ravi Kanth VV, Shelling AN, Rozati R, Sujatha M. Mutational analysis of inhibin alpha gene revealed three novel variations in Indian women with premature ovarian failure. Fertil Steril. 2010;94(1):90-8.
25. Sundblad V, Chiauzzi VA, Andreone L, Campo S, Charreau EH, Dain L. Controversial role of inhibin alpha-subunit gene in the aetiology of premature ovarian failure. Hum Reprod. 2006;21(5):1154-60.
26. Harris SE, Chand AL, Winship IM, Gersak K, Nishi Y, Yanase T, et al. INHA promoter polymorphisms are associated with premature ovarian failure. Mol Hum Reprod. 2005;11(11):779-84.
27. Woad KJ, Watkins WJ, Prendergast D, Shelling AN. The genetic basis of premature ovarian failure. Aust N Z J Obstet Gynaecol. 2006;46(3):242-4. Review.
28. Dixit H, Rao KL, Padmalatha V, Kanakavalli M, Deenadayal M, Gupta N, et al. Expansion of the germline analysis for the INHA gene in Indian women with ovarian failure. Hum Reprod. 2006;21(6):1643-4.
29. Zintzaras E. Inhibin alpha gene and susceptibility to premature ovarian failure: a data synthesis. Mol Hum Reprod. 2009;15(9):551-5.
Política de Privacidade. © Copyright, Todos os direitos reservados.