Desempenho de métodos diagnósticos no rastreio de nefropatia pelo vírus BK em pacientes transplantados renais

Desempenho de métodos diagnósticos no rastreio de nefropatia pelo vírus BK em pacientes transplantados renais

Autores:

Gabriel Godinho Pinto,
Jose Antonio T Poloni,
Liane N. Rotta,
Raymund R. Razonable,
Alessandro C. Pasqualotto

ARTIGO ORIGINAL

Brazilian Journal of Nephrology

versão impressa ISSN 0101-2800versão On-line ISSN 2175-8239

J. Bras. Nefrol. vol.38 no.3 São Paulo jul./set. 2016

http://dx.doi.org/10.5935/0101-2800.20160054

Introdução

Transplante renal é o tratamento de escolha para muitas doenças renais em estágio terminal, que normalmente exigiriam diálise e terapia renal substitutiva.1 Uma das principais ameaças à sobrevivência do enxerto é infecção causada pelo poliomavírus BK (BKV). A prevalência de reativação clinicamente significativa de BKV após o transplante renal varia, dependendo do estudo, entre 1 e 10%, e a incidência de perda de enxerto devido a BKV varia desde valores baixos como 10% até mais de 80% nos pacientes com infecção clinicamente significativa por BKV.2 Uma rápida e sensível detecção de infecção por BKV, seja na urina ou plasma, pode levar ao tratamento precoce, que é crítico para prevenir dano renal irreversível e perda do órgão.

O diagnóstico de nefropatia por BKV requer biópsia do enxerto;3 no entanto, pode ser tarde demais para reverter o dano. Estudos têm demonstrado que as alterações citológicas (células decoy) e o DNA de poliomavírus são detectados na urina, várias semanas antes de ocorrerem os danos renais.2,4 As células decoy podem ser observadas no sedimento urinário como o resultado de células renais e uroteliais infectadas por BKV.5 Apesar de ser um exame relativamente barato, a detecção de células decoy requer perícia considerável e, mesmo assim, não são específicas para a infecção por BKV.6,7 A detecção e quantificação do DNA do BKV podem ser realizadas utilizando-se a reação em cadeia da polimerase em tempo real (qPCR). Embora seja comparativamente mais dispendioso, em comparação com a citopatologia da urina, a qPCR do BKV tem o potencial de ser um exame mais sensível, proporcionar melhor linearidade e independência em comparação com a experiência pessoal do examinador na obtenção de resultados precisos.

Nesta revisão sistemática, buscamos estudos que compararam diretamente o desempenho analítico da citopatologia da urina e da qPCR, para prever o diagnóstico de nefropatia associada ao BKV, como comprovado por exame histopatológico.

Material e métodos

Critério para se considerar a inclusão de estudos para esta revisão

Para a inclusão nesta revisão, selecionamos os estudos envolvendo pacientes que foram submetidos a transplante renal não associado ao recebimento de outros órgãos transplantados.

Tipos de estudos

Incluímos estudos de coorte, prevalência e transversais. Estudos envolvendo 10 ou menos pacientes não foram incluídos.

Tipos de participantes

Somente pacientes adultos (≥ 18 anos de idade) transplantados renais foram consideradas para o estudo, independentemente do gênero, raça ou nacionalidade.

Tipos de intervenções

Uma vez que biópsia é o exame dito padrão ouro para nefropatia por BKV, foram incluídos apenas estudos que compararam as biópsias com citologia urinária e/ou qPCR.

Tipos de medidas de resultado

A medida de desfecho foi a nefropatia causada por BKV, como foi confirmado por biópsia renal. Informações adicionais como carga viral de BKV no plasma e na urina; presença de células decoy na citopatologia urinária; a utilização de coloração com anticorpos SV40 no tecido biopsiado foi investigada e associada ao resultado.

Estratégia de busca

Buscamos artigos no banco de dados eletrônicos PubMed usando a estratégia demonstrada na Tabela 1. A busca foi realizada no dia 14 de fevereiro de 2014, e incluiu todos os documentos encontrados no banco de dados.

Tabela 1 Estratégia de busca utilizada no estudo (PubMed) 

(humanos)
E
(((transplante) OU (sobrevida do enxerto [mh]) OU (“sobrevida do enxerto”) OU (rejeição do enxerto [mh]) OU (“rejeição
do enxerto”))
E
((rim[mh]) Ou (rim) OR (“perda de aloenxerto”) OU (doença renal [mh]) OU (“doença renal”)))
E
((técnicas moleculares de diagnóstico [mh]) OU (“técnicas moleculares de diagnóstico”) OU (biologia molecular [mh])
OU (“biologia molecular”) OU (“biologia molecular”) OU (PCR) OU (“reação em cadeia da polimerase”) OU (“reação
em cadeia da polimerase”) OU (reação em cadeia da polimerase[mh) OU (técnicas citológicas[mh]) OU (“técnicas
citológicas”) OU (“células decoy”) OU (papanicolaou) OU (biópsia) OU (viremia) OU (viruria) OU (“carga viral”))
E
((“vírusBK”) OU (infecção poliomavirus [mh]) OU (“infecção poliomavirus”) OU (poliomavirus) OU (“nefropatia por BK”))

Critérios de exclusão

Trabalhos que não foram escritos em Inglês e/ou estudos que não foram realizados em seres humanos foram excluídos. Uma vez que este estudo teve como objetivo a comparação de exames de diagnóstico, foram excluídos os artigos de revisão, relatos de casos, estudos envolvendo pacientes com menos de 18 anos de idade, estudos de pacientes submetidos a outros procedimentos de transplante (mesmo quando combinados ao renal), estudos de intervenção medicamentosa, estudos em que não foram feitas biópsias para confirmar a nefropatia e estudos que não compararam biópsias com, pelo menos, um dos exames em estudo. Foram feitas tentativas de contato com os autores correspondentes quando os artigos não estavam disponíveis no Pubmed ou quando foi necessária informação adicional. Nas situações em que a resposta não foi recebida, excluímos os respectivos artigos.

Estudos incluidos na revisão e dados de síntese

O fluxograma na Figura 1 mostra o número total de artigos triados e número de manuscritos que preencheram os critérios de inclusão. Dados adicionais foram extraídos a partir destes estudos.

Figura 1 Fluxograma de artigos triados. 

Aspectos éticos

O estudo foi aprovado pelo Conselho de Revisão Institucional (números de protocolo 3531/11 e 915/12).

Resultados

A busca sistemática inicialmente identificou 707 potenciais artigos. No entanto, somente um total de 12 artigos foram incluídos nas análises finais. Um total de 1.694 pacientes transplantados renais foram incluídos nesta revisão (Tabela 2). Usando biópsia como padrão ouro, houve 115 casos (6,8%) de possível nefropatia sem observação do BKV, e 57 casos (3,4%) de nefropatia associada ao poliomavírus (PVAN). O intervalo de sensibilidade, especificidade, VPP (valor preditivo positivo (VPP)) e PVN (valor preditivo negativo (VPN)) usando a qPCR como teste não-invasivo para detectar e prever PVAN no plasma foi de 60-100%; 33-100% ; 7-65% e 72-100%, respectivamente (Tabela 3). O intervalo de carga viral sérica à época do diagnóstico foi de 2,7-7 log. O limiar de ≥ 3.7 log para PVAN teve especificidade de 91% e valor previsto positivo (VPP), de 29%, enquanto que > 4,2 log aumentou a especificidade para 96% e VPP para 50%. Sensibilidade e VPN foram de 100% em ambos os casos.8 Naqueles estudos nos quais foram realizados testes de citologia (n = 506 pacientes), as células decoy foram encontradas em 30,6% (n = 155) dos pacientes. Na comparação com a qPCR, as células decoy apresentaram melhor intervalo de VPN (97-100%), enquanto a sensibilidade, especificidade e VPP foram reduzidos (Tabela 4). Em um estudo, a replicação do BKV indicado pela presença de células decoy na urina, viremia BKV (qPCR), e PVAN (histopatologia) ocorreram em 29%, 13% e 6%, respectivamente; e a mediana do tempo para a detecção foi de 3,7 meses, 5,4 meses e 6,5 meses após o transplante, respectivamente.2 Em todos os estudos, o intervalo de tempo para a detecção de viruria, células decoy e viremia foram de 0,03-12 meses; 0,5-16,1 meses e 0,9-25 meses após o transplante, respectivamente. A detecção precoce (dia 5) de viruria por BKV pode ser capaz de prever a ocorrência de viremia por BKV e nefropatia.9 Além disso, foi demonstrado que a presença de duas ou mais amostras de urina positivas consecutivamente representa uma ferramenta útil para prever viremia por BKV (sensibilidade de 100%; especificidade de 94%; valores preditivos positivos e negativos de 50% e 100%, respectivamente).10 Foi demonstrado que 20% dos pacientes se tornaram virêmicos quando cópias de BKV na urina chegaram a 7 log/ml - uma percentagem que aumentou para 33%, 50 % e 100% a 8 log, 9 log e log ≥ 10, respectivamente.11 Tal associação não foi demonstrada para células decoy.

Tabela 2 Estudos prospectivos que compararam a qPCR, citologia urinária e a biópsia renal no diagnóstico de PVAN nos receptores de transplante de rim 

Autor n Células decoy a Viremia (n) Carga Viral (plasma) Suspeita de PVAN(n)b PVAN + (n)
Hirsch et al. 2 78 23 10 4,4 - 7 log 5 5
Pang et al. 11 183 NA 44 Mediana 2,84 (0-5,86) 0 8
Thamboo et al. 28 97 15 4 3,3 - 5,4 log 7 3
Viscount et al. 8 204 26 16 > 3,7 log 12 4
Almerás et al.24 123 NA 13 2,7 - 5,6 log 11 3
Babel et al. 10 233 NA 16 Média 5,9 (intervalo 4,3-7,5)c 10 6
Helanterä et al. 22 68 NA 0 NA 5 0
Girmanova et al.29 120 NA 6 > 4,5 log 3 3
Pollara et al. 16 75 39 26 2,8 - 6,5 log 19 7
Saundh et al. 9 112 NA 12 Média 5,5 log(intervalo, 3,6 - 6,5) 10 2
Knight et al. 21 349 NA 57 5,7 log (DP ± 5,9) 17 15
Menter et al. 23 52 52 17 > 7 log 16 1

anúmero de pacientes diagnosticados com células decoy à citopatologia;

bNúmero de pacientes com diagnóstico de nefropatia mas sem visualização de BKV por SV40 ou características de alterações virais;

cmédia de pico de carga viral; NA: Não aplicável; PVAN: nefropatia associada aPolyomavirus; DP: desvio-padrão.

Tabela 3 Desempenho da viremia por BKV detectada pela qPCR na predição de PVAN 

Autor Alvo molecular Primer ou probe Sequência (5'-3') Sensibilidade Especificidade VPP VPN
Primer 1, AGCAGGCAAGGG TTCTATTACTAAAT 100 88 50 100
Primer 2, GAAGCAACAGCA GATTCTCAACA
AAGACCCTAAAGACTTT
Hirsch et al. 2 NI Probe CCCTCTGATCTACA CCAGTTT marcado com 6-carboxifluoresceína na extremidade 5` e
6-carboxitetrametilrodamina na
extremidade 3
BKpangF ATGTGACCA ACACAGC 60 76 65 72
BKpangF ATGTGACCA ACACAGC
Pang et al. 11 VP1 gene BKpangP1 AGGAGAACCCAGA GAGTGGA-fluoresceína
BKpangP2 LC-Red 640-GGCAGCCTATGT ATGGTATGGAA-fosfato
(5`-AGG TAG AAG AGG TTA GGG
TGT TTG ATG GCA CAG-3`)
Thamboo et al. 28 VP1 gene NI marcação dupla na extremidade 5` com 6-carboxiyfluorosceína 67 33 20 80
(FAM) e a extremidade 3` com
6-carboxitetrametilrodamina (TAMRA)
Primer PoL1s, CACTTTTGGGGGACCTAGT 100 96 50 100
Viscount et al. 8 VP2 gene Primer PoL2as, Probe 1, CTCTACAGTAGCA AGGGATGC TCTGAGGCTGCTGCT
PoLP1, GCCACAGGATTTT-fluoresceína
Probe 2, LC-Red 640-AGTAG CTGAAATTGCTG
PoLP2, CTGGAGAGGCTGCT-fosfato
Primer PoL1s, CACTTTTGGGGGACCTAGT 100 91 15 100
Almerás et al. 24 Gene VP2 Primer PoL2as, Sonda 1, PoLP1, , CTCTACAGTAGCAAGGGATGC TCTGAGGCTGC TGCTGCCA CAGGATTTT-fluoresceína
Sonda 2, PoLP2, LC-Red 640-AGTAGCTG AAATTGCTGC TGGAGAGGCTGCT-fosfato
Babel et al. 10 VP1 gene NI NI 100 96 43 100
Girmanova et al. 29 Gene que codifica T Ag grande Kit comercial BKV Q-PCR Kit de alerta de detecção (Chemagen) 100 68 7 100
Pollara et al. 16 Gene que codifica T Ag grande Kit comercial BKV Q. Kit alerta (Nanogen Advanced Diagnostics, Itália) 95 100 NI NI
Saundh et al. 9 Gene que codifica T Ag grande BKV para frente BKV para trás BKV Sonda TGA CTA AGA AAC TGG TGT AGA TCA YTCC TT TAAT GA AAA ATG GGA FAM AGT GTT GAG AAT CTG CTG TTG CTT C BHQ-1 100 91 17 100
Knight et al. 21 NI NI NI 100 87 26 100
Primer 1, AGCAGGCAAGGGTTCTATTACTAAAT 100 57 41 100
Primer 2, GAAGCAACAGCAGATTCTCAACA
Menter et al.23 NI Sonda AAGACCCTAAAGACTTTCCCTCTGAT CTACACCAGTTT marcado com 6-carboxifluoresceína na extremidade
6’-carboxitetrametilrodamina na
extremidade 3`

Ag: Antígeno; BKV: BK vírus; NI: Não informado; VPN: Valor Preditivo Positivo; VPP: Valor Preditivo Positivo PVAN: nefropatia associada à poliomavirus.

Tabela 4 Desempenho da citopatologia urinária na predição da PVAN 

Autor Célula Decoy (n) PVAN (n) Sensibilidade Especificidade PPV NPV
Hirsch et al. 2 23 5 100 71 29 100
Thamboo et al. 28 15 3 67 85 20 98
Viscount et al. 8 26 4 25 85 5 97
Pollara et al. 16 39 7 100 53 18 100

VPN: valor preditivo negativo; VPN: valor preditivo positivo; PVAN: nefropatia associada ao poliomavírus.

Discussão

Este estudo mostra a escassez de dados na literatura sobre a comparação do desempenho da qPCR (sangue ou urina) e citopatologia urinária para o diagnóstico de PVAN. Parece claro que a viruria (definida como detecção de DNA de BKV na urina) precede a detecção de células decoy na citologia urinária, que antecede viremia e PVAN.2 A detecção de células decoy e viruria BKV são importantes marcadores de replicação de BKV, mas pobres preditores de PVAN.

O ponto de corte para determinar a relevância clínica da viremia por BKV permanece controverso. A Sociedade Americana de Transplante (AST) recomenda que, na presença de cargas plasmáticas > 4 log por três ou mais semanas, deve-se presumir um diagnóstico de PVAN e considerar uma biópsia para se chegar ao diagnóstico definitivo.12 Enquanto a Sociedade Americana de Transplante e o Grupo para Melhorias Globais no Desfecho de Doenças Renais (KDIGO) sugerem uma carga viral de BK de 4 log de cópias (10.000 cópias) como um valor de corte para PVAN. Não há métodos padronizados ou aprovados pela agência reguladora nortemericana, FDA, para avaliação da carga viral BK. O diagnóstico de BKV está atualmente baseado em diferentes abordagens usando a qPCR, mas uma vez que não existe um método padrão para avaliação da carga viral de BKV, é essencial que as instituições implementem estudos de validação clínica, certificando suas próprias metodologias a serem usadas como um guia para tratamento clínico.2,13-19

O diagnóstico definitivo de PVAN é feito pela histopatologia,20 em um contexto em que a infecção viral pode ser difícil de diferenciar a partir da rejeição de órgãos. Na nossa análise, apenas quatro artigos relataram o uso da coloração de SV40 no exame histopatológico.21-24 Portanto, a ausência de um exame de confirmação pode subestimar a real frequência da PVAN. O SV40 deve ser usado quando há suspeita clínica de infecção por BKV, apesar da ausência de alterações visíveis no tecido examinado.25 A AST recomenda um mínimo de duas biópsias de fragmento, preferencialmente com tecido medular, com a intenção de reduzir o diagnóstico falso negativo de PVAN, que pode ser tão elevada quanto 20-30% (12, 26). Portanto, uma biópsia negativa não descarta a presença de PVAN.26

Conclusão

Este estudo demonstra a escassez de dados na literatura sobre a comparação de exames diagnósticos para a predição de PVAN. A qPCR tem um melhor desempenho diagnóstico global do que a citopatologia urinária para a detecção de PVAN. No entanto, o ponto de corte para exames de qPCR permanecem pouco definidos. Em contraste com o citomegalovírus (CMV), para o qual a Organização Mundial de Saúde produziu padrões internacionais,27 existe uma necessidade de padronização dos exames relacionados ao BKV. Em última análise, são necessários estudos prospectivos adicionais, a fim de elucidar o ponto de corte ideal para a carga viral no plasma e na urina, para o diagnóstico precoce de PVAN, bem como o momento de ocorrência da viremia, e cofatores associados ao receptor do transplante.

REFERÊNCIAS

1 Hume DM, Merrill JP, Miller BF, Thorn GW. Experiences with renal homotransplantation in the human: report of nine cases. J Clin Invest 1955;34:327-82. DOI:
2 Hirsch HH, Knowles W, Dickenmann M, Passweg J, Klimkait T, Mihatsch MJ, et al. Prospective study of polyomavirus type BK replication and nephropathy in renal-transplant recipients. N Engl J Med 2002;347:488-96. PMID: 12181403 DOI:
3 Hirsch HH, Brennan DC, Drachenberg CB, Ginevri F, Gordon J, Limaye AP, et al. Polyomavirus-associated nephropathy in renal transplantation: interdisciplinary analyses and recommendations. Transplantation 2005;79:1277-86. PMID: 15912088 DOI:
4 Brennan DC, Agha I, Bohl DL, Schnitzler MA, Hardinger KL, Lockwood M, et al. Incidence of BK with tacrolimus versus cyclosporine and impact of preemptive immunosuppression reduction. Am J Transplant 2005;5:582-94. DOI:
5 Poloni JA, Pinto GG, Pasqualotto AC, Rotta LN. Decoy cells due to polyomavirus BK infection in the urine sediment of a patient with lupus nephritis. Lupus 2013;22:1547-8. DOI:
6 Kahan AV, Coleman DV, Koss LG. Activation of human polyomavirus infection-detection by cytologic technics. Am J Clin Pathol 1980;74:326-32. PMID: 6251715 DOI:
7 Traystman MD, Gupta PK, Shah KV, Reissig M, Cowles LT, Hillis WD, et al. Identification of viruses in the urine of renal transplant recipients by cytomorphology. Acta Cytol 1980;24:501-10.
8 Viscount HB, Eid AJ, Espy MJ, Griffin MD, Thomsen KM, Harmsen WS, Razonable RR, et al. Polyomavirus polymerase chain reaction as a surrogate marker of polyomavirus-associated nephropathy. Transplantation 2007;84:340-5. PMID: 17700158 DOI:
9 Saundh BK, Baker R, Harris M, Welberry Smith MP, Cherukuri A, Hale A. Early BK polyomavirus (BKV) reactivation in donor kidney is a risk factor for development of BKV-associated nephropathy. J Infect Dis 2013;207:137-41. DOI:
10 Babel N, Fendt J, Karaivanov S, Bold G, Arnold S, Sefrin A, et al. Sustained BK viruria as an early marker for the development of BKV-associated nephropathy: analysis of 4128 urine and serum samples. Transplantation 2009;88:89-95. PMID: 19584686 DOI:
11 Pang XL, Doucette K, LeBlanc B, Cockfield SM, Preiksaitis JK. Monitoring of polyomavirus BK virus viruria and viremia in renal allograft recipients by use of a quantitative real-time PCR assay: one-year prospective study. J Clin Microbiol 2007;45:3568-73. PMID: 17855578 DOI:
12 Hirsch HH, Randhawa P; AST Infectious Diseases Community of Practice. BK virus in solid organ transplant recipients. Am J Transplant 2009:S136-46. PMID: 20070673 DOI:
13 Randhawa P, Kant J, Shapiro R, Tan H, Basu A, Luo C. Impact of genomic sequence variability on quantitative PCR assays for diagnosis of polyomavirus BK infection. J Clin Microbiol 2011;49:4072-6. DOI:
14 Hirsch HH, Drachenberg CB, Steiger J, Ramos E. Polyomavirus-associated nephropathy in renal transplantation: critical issues of screening and management. Adv Exp Med Biol 2006;577:160-73. PMID: 16626034
15 Bechert CJ, Schnadig VJ, Payne DA, Dong J. Monitoring of BK viral load in renal allograft recipients by real-time PCR assays. Am J Clin Pathol 2010;133:242-50. PMID: 20093233 DOI:
16 Pollara CP, Corbellini S, Chiappini S, Sandrini S, De Tomasi D, Bonfanti C, et al. Quantitative viral load measurement for BKV infection in renal transplant recipients as a predictive tool for BKVAN. New Microbiol 2011;34:165-71.
17 Hassan S, Mittal C, Amer S, Khalid F, Patel A, Delbusto R, et al. Currently recommended BK virus (BKV) plasma viral load cutoff of = 4 log10/mL underestimates the diagnosis of BKV-associated nephropathy: a single transplant center experience. Transpl Infect Dis 2014;16:55-60. DOI:
18 Kudose S, Dong J. Clinical validation study of quantitative real-time PCR assay for detection and monitoring of BK virus nephropathy. Ann Clin Lab Sci 2014;44:455-60. PMID: 25361932
19 Mitui M, Leos NK, Lacey D, Doern C, Rogers BB, Park JY. Development and validation of a quantitative real time PCR assay for BK virus. Mol Cell Probes 2013;27:230-6. DOI:
20 Solez K, Colvin RB, Racusen LC, Haas M, Sis B, Mengel M, et al. Banff 07 classification of renal allograft pathology: updates and future directions. Am J Transplant 2008;8:753-60. DOI:
21 Knight RJ, Gaber LW, Patel SJ, DeVos JM, Moore LW, Gaber AO. Screening for BK viremia reduces but does not eliminate the risk of BK nephropathy: a single-center retrospective analysis. Transplantation 2013;95:949-54. DOI:
22 Helanterä I, Ortiz F, Auvinen E, Räisänen-Sokolowski A, Lappalainen M, Lautenschlager I, et al. Polyomavirus BK and JC infections in well matched Finnish kidney transplant recipients. Transpl Int 2009;22:688-93. DOI:
23 Menter T, Mayr M, Schaub S, Mihatsch MJ, Hirsch HH, Hopfer H. Pathology of resolving polyomavirus-associated nephropathy. Am J Transplant 2013;13:1474-83. DOI:
24 Alméras C, Foulongne V, Garrigue V, Szwarc I, Vetromile F, Segondy M, et al. Does reduction in immunosuppression in viremic patients prevent BK virus nephropathy in de novo renal transplant recipients? A prospective study. Transplantation 2008;85:1099-104. PMID: 18431228 DOI:
25 Bohl DL, Brennan DC. BK virus nephropathy and kidney transplantation. Clin J Am Soc Nephrol 2007;2:S36-46. DOI:
26 Drachenberg CB, Papadimitriou JC, Hirsch HH, Wali R, Crowder C, Nogueira J, et al. Histological patterns of polyomavirus nephropathy: correlation with graft outcome and viral load. Am J Transplant 2004;4:2082-92. DOI:
27 NIBSC/Medicines and Healthcare Products Regulatory Agency/World Health Organization. WHO International Standard - 1st WHO International Standard for Human Cytomegalovirus for Nucleic Acid Amplification Techniques - NIBSC code: 09/162 - Instructions for use (Version 6.0, Dated 09/10/2014). [Cited 2014 Nov 11]. Available from:
28 Thamboo TP, Jeffery KJ, Friend PJ, Turner GD, Roberts IS. Urine cytology screening for polyoma virus infection following renal transplantation: the Oxford experience. J Clin Pathol 2007;60:927-30. DOI:
29 Girmanova E, Brabcova I, Bandur S, Hribova P, Skibova J, Viklicky O. A prospective longitudinal study of BK virus infection in 120 Czech renal transplant recipients. J Med Virol 2011;83:1395-400. PMID: 21618550 DOI:
Política de Privacidade © Copyright, Todos os direitos reservados.