Estudo de expressão transcricional no sistema nervoso central de ratos: qual gene deve ser usado como controle interno?

Estudo de expressão transcricional no sistema nervoso central de ratos: qual gene deve ser usado como controle interno?

Autores:

Ana Carolina de Moura,
Virgínia Meneghini Lazzari,
Grasiela Agnes,
Silvana Almeida,
Márcia Giovenardi,
Ana Beatriz Gorini da Veiga

ARTIGO ORIGINAL

Einstein (São Paulo)

versão impressa ISSN 1679-4508versão On-line ISSN 2317-6385

Einstein (São Paulo) vol.12 no.3 São Paulo jul./set. 2014

http://dx.doi.org/10.1590/s1679-45082014ao3042

INTRODUÇÃO

Algumas estruturas no sistema nervoso central (SNC), como bulbo olfatório (OB), hipocampo (HP), estriado (ST), córtex pré-frontal (PFC), amígdala medial posterodorsal (MePD) e área pré-óptica medial (MPOA), são responsáveis pela aparência e pela manutenção de diferentes comportamentos.(1,2) A compreensão dos mecanismos moleculares envolvidos na regulação das vias de sinalização no SNC serviu de base para muitos estudos, que visaram analisar como um padrão de comportamento é controlado pela expressão de um gene candidato ou de grupo de genes.(3-5) Assim, ensaios sobre a expressão de genes são cada vez mais usados em estudos comportamentais com modelos animais, com base na análise de transcritos específicos no SNC e sua associação com diferentes padrões de comportamento.

Os níveis de expressão de um gene dentro de uma célula podem ser alterados por diversas condições, como a fase do ciclo celular ou a exposição a drogas, hormônios, citocinas ou outros estímulos. Logo, a análise da expressão de genes requer medidas precisas e reprodutíveis de sequências específicas de ácido ribonucleico mensageiro (mRNA). O método mais comum de quantificação de mRNA é a amplificação de moléculas individuais de RNA, pela combinação de transcrição reversa e pela reação da cadeia de polimerase em tempo real (RT-PCR),(6) que permitem uma quantificação sensível e acurada dos níveis de expressão de mRNA. Mesmo assim, é necessário haver seleção de uma estratégia apropriada de normalização para excluir possíveis erros experimentais, fornecendo, desse modo, dados mais confiáveis. A maioria dos experimentos de expressão gênica requer isolamento e processamento do ácido ribonucleico (RNA), e a quantidade final de RNA pode variar entre as amostras. A realização de análises RT-PCR demanda parâmetros controlados para a obtenção de medidas quantitativas confiáveis de expressão. Estas incluem variações na quantidade da amostra inicial, recuperação de RNA, integridade de RNA, eficiência de síntese do ácido desoxirribonucleico complementar (cDNA) e diferenças na atividade geral de transcrição dos tecidos ou células analisados.(7,8)

A abordagem usada mais frequentemente para normalização em estudos de expressão gênica é o emprego de um controle interno ou gene de referência endógeno, frequentemente chamado de gene housekeeping (HKG). Os HKG codificam proteínas que oferecem funções básicas, essenciais, das quais todas as células necessitam para sobreviver. Eles devem ter níveis de expressão estáveis em diferentes tipos de células e tecidos, por todos os estágios de desenvolvimento, e mesmo em várias condições. Entretanto, vários estudos mostraram que os níveis de transcrição de HKG usados tradicionalmente podem variar de forma considerável em células específicas em condições experimentais diferentes.(7-10)

Nos últimos anos, ficou claro que nenhum gene isolado é expresso constitutivamente em todos os tipos de células e sob todas as condições experimentais, sugerindo que a estabilidade de expressão do gene de controle considerado tem de ser verificada antes de cada modelo experimental particular.(7) Para que um gene seja usado como controle interno, diversos critérios devem ser satisfeitos: o mRNA tem de ser expresso de modo consistente no mesmo nível em todas as amostras sob investigação, independentemente do tipo de tecido, estado de doença, medicação ou condição experimental; os níveis de expressão têm de ser comparáveis aos do alvo; e a amplificação do dado gene de referência deve ser específica para o RNA. A importância da escolha de um controle interno confiável é salientada pelo fato de que o uso de um gene de referência instável para normalização pode obscurecer as reais alterações ou produzir modificações artificiais na expressão do gene. Assim, a validação de um HKG para cada situação experimental é um requerimento crucial para a aquisição de dados biológicos significantes.(8,11) Para estudos mais generalizados, são recomendados o uso do nível geométrico médio de expressão de vários genes para normalização e também o uso de três a cinco genes de controle diferentes, dependendo do tecido a ser estudado.(12)

Ainda não foi realizado um estudo sistemático que comparasse a capacidade de adequação de genes de referência candidatos no sistema nervoso central de ratos. Os resultados apresentados neste estudo podem ser úteis em análises posteriores de expressão gênica no cérebro de ratos.

OBJETIVO

O objetivo do presente estudo foi selecionar uma amostra para analisar regiões distintas do cérebro e avaliar as áreas mais estáveis do gene housekeeping do sistema nervoso central, relacionadas a vários comportamentos sociais.

MÉTODOS

Animais

Foram usadas ratas Wistar virgens (n=6) com pelo menos 3 ciclos regulares consecutivos, no período diestro, com aproximadamente 90 dias de idade, do biotério da Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), em Porto Alegre (RS). Elas foram abrigadas em grupos de três em gaiolas de Plexiglas® (46cm × 17cm × 31cm). Alimento e água foram oferecidos à vontade. Os animais foram abrigados em condições controladas de temperatura (21±1°C) e de luz (ciclos claro-escuro 12:12, com as luzes apagadas às 17h).

Todos os procedimentos foram realizados de 2009 a 2012, em conformidade com as Diretrizes da Sociedade Brasileira de Neurociências e Comportamento para o cuidado e uso de animais de laboratório, e os protocolos foram aprovados pelo Comitê de Ética em Pesquisa da UFCSPA (protocolo 590/08).

Seleção de gene de referência e desenho de primer

Genes de referência candidatos foram selecionados entre os mais comumente usados na literatura. Os primers para ciclofilina A (CypA) estavam de acordo com o que foi descrito por Peinnequin et al.(13) e Langnaese et al.(8) Os primers de beta-actina (ActB) e ubiquitina C (UbC) foram projetados usando o software Primer3, com base em sequências de ratos no banco de dados GenBank. A especificidade dos primers foi verificada usando a ferramenta de busca Basic Local Alignment Search Tool (BLAST) para coleção de nucleotídeos (nr) do banco de dados do National Center for Biotechnology Information (NCBI). Todos os primers foram da Invitrogen® (São Paulo, Brasil). A sequência de primers usados está descrita na tabela 1.

Tabela 1 Genes housekeeping selecionados para este estudo, sequências de primers e função do gene 

HKG Primer F Primer R Função (Langnaese et al.)(8)
ActB 5’TATGCCAACACAGTGCTGTCTGG3’ 5’TACTCCTGCTTGCTGATCCACAT3’ Proteína do citoesqueleto estrutural
CypA 5’TATCTGCACTGCCAAGACTGAGTG3’ 5’CTTCTTGCTGGTCTTGCCATTCC3’ Acelera o dobramento nos oligopeptídeos
UbC 5’TTTCCATAGACAATGCAGATCTTT3’ 5’AGGGTGGACTCCTTCTGGAT3’ Degradação de proteínas

ActB: beta-actina; CypA: ciclofilina A; UbC: ubiquitina C.

Amostras de tecido cerebral

Para determinar a regularidade do ciclo estral, foram colhidos esfregaços vaginais das ratas virgens durante 2 semanas antes do início do experimento. Após a ocorrência de três ciclos estrais regulares, os experimentos foram feitos na manhã da fase diestro. As ratas foram decapitadas e seus cérebros foram rapidamente removidos. As regiões OB, HP, ST e PFC foram dissecadas do hemisfério esquerdo. Logo depois, as amostras dissecadas foram colocadas em tubos contendo RNAlater® (Life Technologies, São Paulo, Brasil) e armazenadas a -80°C.

Análises moleculares

O RNA total foi extraído de amostras usando TRIzol® (Invitrogen®, São Paulo, Brasil). Rapidamente, cada estrutura cerebral foi homogeneizada na presença de TRIzol®; acrescentou-se clorofórmio (1:5, v/v) e obteve-se a fase aquosa após centrifugação (12.000×g, 15 minutos). O RNA foi precipitado com isopropanol por 15 minutos em temperatura ambiente, seguido por centrifugação a 12.000×g por 10 minutos. Os pellets foram novamente suspensos em água tratada com 0,1% dietilpirocarbonato (DEPC) e o RNA foi quantificado por espectrofotometria. A concentração total de RNA foi determinada pela mensuração da densidade óptica a 260nm e a pureza do RNA foi avaliada com base na proporção 260nm/280nm e eletroforese em gel de agarose.(8)

A RT-PCR semiquantitativa é bem aceita e amplamente usada como um método valido para análise de expressão gênica nas áreas do cérebro, como já descrito em outros trabalhos.(14-16) Para a transcrição reversa, 1μg de RNA total foi usado como molde para sintetizar cDNA. RNA foi incubado com 1μL de oligo(dT) (0,5μg/μL, Invitrogen®, São Paulo, Brasil), 1μL de desoxirribonucleotídeo trifosfato (dNTPs) (10mM) e água-DEPC para um volume final de 12μL, por 5 minutos a 65°C e, depois, por 1 minuto em gelo. Os seguintes reagentes foram então adicionados para atingir um volume final de 19μL:4μL de tampão RT-PCR (50mM TrisHCl, pH 8,3, 75mM KCl, 3mM MgCl2) e 2μL de DTT® (0,1M). Após 2 minutos de incubação a 37°C, 1μL da transcriptase reversa codificada pelo moloney murine leukemia virus reverse transcriptase (M-MLV-RT) (200U/μL, Invitrogen®, São Paulo, Brasil) foi adicionado e a síntese de cDNA foi feita a 50°C por 1 hora. A reação foi inativada por incubação a 70°C por 15 minutos.

A amplificação dos genes de referência foi feita usando 7,5μL de SYBR® green polymerase chain reaction (PCR) master mix (Applied Biosystems®, São Paulo, Brasil), 0,5μL de primers forward e reverse (0,33µM cada), 100ng de cDNA e água livre de nuclease, em um volume total de 15μL. As reações foram feitas em uma placa óptica de 96 poços, usando um termociclador StepOnePlus® (Applied Biosystems®, Foster City, CA, EUA). Após o passo inicial de desnaturação a 95°C por 10 minutos, a amplificação foi realizada em 50 ciclos de desnaturação a 95°C por 30 segundos, com anelamento de 60°C por 40 segundos e extensão a 72°C por 40 segundos. A amplificação foi seguida por uma análise de curva de fusão para confirmar a especificidade do produto do PCR. Nenhum sinal foi detectado nos controles sem molde (no-template). O limiar do ciclo (Ct) experimental foi calculado usando os algoritmos de realce fornecidos pelo equipamento. Todas as amostras foram processadas em duplicata, e o valor médio de cada duplicata foi usado para todos os cálculos restantes.(8,10,17)

Determinação da estabilidade de expressão do gene de referência

Foi usada a ferramenta disponível publicamente NormFinder (um aplicativo Visual Basic para Microsoft Excel) para analisar a estabilidade de expressão do gene. Ela faz a classificação dos HKG, segundo sua estabilidade de expressão, usando uma abordagem baseada em modelo. O programa estima a variação de expressão tanto intragrupo como intergrupo e calcula os valores de estabilidade do gene candidato.(7,8)

O relato dos dados obtidos dos valores brutos de Ct representa de maneira falsa a variação e erros, devendo ser evitado. Assim, a expressão de cada HKG foi calculada a partir da fórmula 2-Ct. Este cálculo transforma os dados logarítmicos de Ct em um valor linear. A forma 2-Ct descreve, de modo mais preciso, a variação individual entre as reações de replicação.(6,18) Consequentemente, o NormFinder requer a transformação de valores de Ct em quantidades de expressão numa escala linear, de forma que os valores médios de Ct foram, então, exportados para Microsoft Excel e alterados para a forma 2-Ct, e depois as quantidades calculadas foram colocadas no NormFinder,(19) onde o candidato com expressão mais estável no conjunto da amostra é o gene com a primeira colocação, que tem o menor valor de estabilidade.(20)

RESULTADOS

Na classificação de genes candidatos de normalização com o NormFinder, foram obtidos os valores de estabilidade. As figuras 1 a 4 mostram que em HP e ST, o HKG mais estável foi ActB. Por outro lado, Cyp A e UbC foram mais estáveis em PFC e OB, respectivamente.

Figura 1 Estabilidade do gene housekeeping no córtex pré-frontal 

Figura 2 Estabilidade do gene housekeeping no hipocampo 

Figura 3 Estabilidade do gene housekeeping no bulbo olfatório 

Figura 4 Estabilidade do gene housekeeping no estriado 

DISCUSSÃO

Em alguns estudos de expressão gênica no SNC, ActB se mostrou tão estável quanto gliceraldeído-3-fosfato desidrogenase (GAPDH), mas sua estabilidade depende dos tecidos e das condições usados nas análises.(21,22) Chen et al.(23) verificaram que outros genes constitutivos, como o fator de alongamento da tradução eucariótica (EF, do inglês elongation factor) e GAPDH são mais estáveis do que ActB em algumas áreas do cérebro, como o córtex auditivo e a cóclea de ratos, e que devem, portanto, ser considerados genes de referência em análises quantitativas de expressão gênica nessas regiões. Todavia, muitos estudos baseados em RT-PCR para avaliar a expressão de genes em diferentes regiões do cérebro – como PFC, ST, HP e cerebelo – utilizam ActB como gene de referência.(14-16,24)

Nossos resultados mostram que ActB é o HKG mais estável no HP do conjunto de nossa amostra. Em um estudo realizado por Langnaese et al.,(8) ActB e CypA provaram ser os genes mais estáveis no HP de sua análise. Esses dois HKG foram também usados como genes de controle em um estudo por Nishida et al.,(25) porque seus níveis de expressão são considerados estáveis nessa área do cérebro. Por outro lado, Honkaniemi et al.(26) usaram apenas CypA em um modelo de isquemia que analisa a expressão gênica no HP.

No ST, também identificamos ActB como o gene mais estável. Contudo, Benn et al.(9) verificaram que UbC é mais estável que ActB nessa área. Honkaniemi et al.(26) examinaram a expressão de CypA para comparar as alterações isquêmicas com os níveis gerais de transcrição no ST.

CypA demonstrou a expressão mais estável no PFC segundo nossa análise. Estudos anteriores de níveis de expressão gênica usaram principalmente um dos HKG mais tradicionais, como GAPDH, 18S ou CypA, no cérebro inteiro de ratos Wistar adultos.(17) Honkaniemi et al.(26) também examinaram a expressão de CypA no córtex de ratos em um modelo isquêmico. Ademais, Benn et al.(9) identificaram UbC como tendo expressão estável no córtex, em vez de ActB. Contudo, Yamada et al.(27) usaram ActB como referência para amplificação de genes, além de Soria-Fregozo et al.,(14) que escolheram ActB como um controle interno para quantificar mRNA no PFC.

Vimos que UbC é o HKG mais estável no OB. UbC já foi usada em vários estudos de expressão gênica, como no cérebro humano(24,28) e fígado de rato.(29) Todavia, Wong et al.(30) analisaram a expressão de ActB e CypA no OB de ratos.

Nosso estudo teve algumas limitações. Após a extração de RNA com TRIzol®, as amostras não foram incubadas com DNAse, mas a pureza do RNA foi verificada por eletroforese em gel de agarose e nenhum DNA estava presente nas amostras. Outra limitação foi o fato de as análises serem baseadas em RT-PCR semiquantitativa. Mesmo que os estudos mais recentes sobre a expressão de genes sejam baseados em PCR quantitativo, muitas investigações foram baseadas em RT-PCR convencional. Aliás, essa foi a técnica molecular para análise de expressão gênica mais usada até recentemente e, portanto, seu uso não prejudica nossos resultados ou outros achados anteriores.

CONCLUSÃO

As variações na estabilidade dos genes housekeeping nas diferentes áreas do sistema nervoso central ocorrem provavelmente devido à variabilidade nas amostras usadas em cada estudo. Assim, a validação dos genes de referência para cada situação experimental é um requisito essencial para aquisição de dados significativos e confiáveis para qualquer tipo de análise. Uma vez selecionado o gene housekeeping para cada área do sistema nervoso central, as análises adicionais podem ser feitas com a segurança do uso de um gene de controle mais estável.

REFERÊNCIAS

1. de Castilhos J, Marcuzzo S, Forti CD, Frey RM, Stein D, Achaval M, et al. Further studies on the rat posterodorsal medial amygdala: dendritic spine density and effect of 8-OH-DPAT microinjection on male sexual behavior. Brain Res Bull. 2006;69(2):131-9.
2. Rasia-Filho AA, Haas D, de Oliveira AP, de Castilhos J, Frey R, Stein D, et al. Morphological and functional features of the sex steroid-responsive posterodorsal medial amygdala of adult rats. Mini Rev Med Chem. 2012; 12(11):1090-106. Review.
3. Röskam S, Koch M. Effects of neonatal and peripubertal ethanol treatment on various aspects of adult rat behavior and brain anatomy. Int J Dev Neurosci. 2009;27(3):249-56.
4. Djordjevic J, Djordjevic A, Adzic M, Radojcic MB. Effects of chronic social isolation on Wistar rat behavior and brain plasticity markers. Neuropsychobiology. 2012;66(2):112-9.
5. Ruthschilling CA, Albiero G, Lazzari VM, Becker RO, Moura AC, Giovenardi M, et al. Analysis of transcriptional levels of the oxytocin receptor in different areas of the central nervous system and behaviors in high and low licking rats. Behav Brain Res. 2012;228(1):176-84.
6. Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal Biochem. 2000;285(2):194-204.
7. Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004;64(15):5245-50.
8. Langnaese K, John R, Schweizer H, Ebmeyer U, Keilhoff G. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model. BMC Mol Biol. 2008;9:53.
9. Benn CL, Fox H, Bates GP. Optimisation of region-specific reference gene selection and relative gene expression analysis methods for pre-clinical trials of Huntington’s disease. Mol Neurodegener. 2008;3:17.
10. Cook NL, Kleinig TJ, van den Heuvel C, Vink R. Reference genes for normalising gene expression data in collagenase-induced rat intracerebral haemorrhage. BMC Molecular Biology. 2010;11:7.
11. Gubern C, Hurtado O, Rodríguez R, Morales JR, Romera VG, Moro MA, et al. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia. BMC Mol Biol. 2009;10:57.
12. Barber RD, Harmer DW, Coleman RA, Clark BJ. GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol Genomics. 2005;21(3):389-95.
13. Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarençon D, et al. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunol. 2004;5:3.
14. Soria-Fregozo C, Pérez-Vega MI, González-Burgos I, Feria-Velasco A, Beas-Zárate C. Prefrontal serotonergic denervation induces increase in the density of 5-HT2A receptors in adult rat prefrontal cortex. Neurochem Res. 2008;33(11):2350-7.
15. Hatami H, Hossainpour-Faizi MA, Azarfarin M, Azarfam P. Chronic ecstasy use increases neurotrophin-4 gene expression and protein levels in the rat brain. Pharmacol Rep. 2010;62(6):998-1004.
16. Blanco E, Campos-Sandoval JA, Palomino A, Luque-Rojas MJ, Bilbao A, Suárez J, et al. Cocaine modulates both glutaminase gene expression and glutaminase activity in the brain of cocaine-sensitized mice. Psychopharmacology (Berl). 2012;219(4):933-44.
17. Nelissen K, Smeets K, Mulder M, Hendriks JJ, Ameloot M. Selection of reference genes for gene expression studies in rat oligodendrocytes using quantitative real time PCR. J Neurosci Methods. 2010;187(1):78-83.
18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods. 2001;25(4):402-8.
19. MOMA - Department of Molecular Medicine. Aarhus University Hospital. Molecular Diagnostic Laboratory [Internet]. Denmark: Department of Molecular Medicine, Aarhus University Hospital. NormFinder software version 20, 2010 [software]. [cited 2014 Aug 10]. Available from:
20. MOMA - Department of Molecular Medicine. Aarhus University Hospital. Molecular Diagnostic Laboratory [Internet]. Denmark: Department of Molecular Medicine, Aarhus University Hospital, Documentation for NormFinder version 20, 2010 [cited 2014 Aug 10]. Available from:
21. Tanic N, Perovic M, Mladenovic A, Ruzdijic S, Kanazir S. Effects of aging, dietary restriction and glucocorticoid treatment on housekeeping gene expression in rat cortex and hippocampus-evaluation by real time RT-PCR. J Mol Neurosci. 2007;32(1):38-46.
22. Bonefeld BE, Elfving B, Wegener G. Reference genes for normalization: a study of rat brain tissue. Synapse. 2008;62(4):302-9.
23. Chen J, Ruan R. Identifying stable reference genes for evaluation of antioxidative enzyme gene expression in auditory cortex and cochlea of young and old Fischer 344 rats. Acta Otolaryngol. 2009;129(6):644-50.
24. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):RESEARCH0034.
25. Nishida Y, Sugahara-Kobayashi M, Takahashi Y, Nagata T, Ishikawa K, Asai S. Screening for control genes in mouse hippocampus after transient forebrain ischemia using high-density oligonucleotide array. J Pharmacol Sci. 2006;101(1):52-7.
26. Honkaniemi J, States BA, Weinstein PR, Espinoza J, Sharp FR. Expression of zinc finger immediate early genes in rat brain after permanent middle cerebral artery occlusion. J Cereb Blood Flow Metab. 1997;17(6):636-46.
27. Yamada M, Iwabuchi T, Takahashi K, Kurahashi C, Ohata H, Honda K, et al. Identification and expression of frizzled-3 protein in rat frontal cortex after antidepressant and electroconvulsive treatment. J Pharmacol Sci. 2005; 99(5):239-46.
28. Coulson DT, Brockbank S, Quinn JG, Murphy S, Ravid R, Johnston JA, et al. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue. BMC Molecular Biol. 2008;9:46.
29. Xing W, Deng M, Zhang J, Huang H, Dirsch O, Dahmen U. Quantitative evaluation and selection of reference genes in a rat model of extended liver resection. J Biomol Techn. 2009;20(2):109-15.
30. Wong CC, Poon WH, Tsim TY, Wong EY, Leung MS. Gene expressions during the development and sexual differentiation of the olfactory bulb in rats. Brain Res Dev Brain Res. 2000;119(2):187-94.
Política de Privacidade © Copyright, Todos os direitos reservados.