Mistura de Ácido Gálico e Ciclosporina e seus Efeitos sobre a Disfunção Cardíaca Induzida pela Isquemia / Reperfusão e Expressão de eNOS/iNOS

Mistura de Ácido Gálico e Ciclosporina e seus Efeitos sobre a Disfunção Cardíaca Induzida pela Isquemia / Reperfusão e Expressão de eNOS/iNOS

Autores:

Mohammad Badavi,
Najmeh Sadeghi,
Mahin Dianat,
Alireza Samarbafzadeh

ARTIGO ORIGINAL

International Journal of Cardiovascular Sciences

versão impressa ISSN 2359-4802versão On-line ISSN 2359-5647

Int. J. Cardiovasc. Sci. vol.30 no.3 Rio de Janeiro maio/jun. 2017

http://dx.doi.org/10.5935/2359-4802.20170047

Introdução

O fornecimento interrompido de oxigênio acompanhado por isquemia miocárdica leva ao declínio mitocondrial no fluxo da cadeia transportadora de elétrons (CTE) cujo o resultado é o subsequente inchaço e degeneração mitocondrial. Nesse caso o ATP está esgotado, de modo que abre-se o caminho para a necrose e morte mitocondrial com o início da permeabilidade mitocondial com a abertura dos poros de transição de permeabilidade mitocondrial (mPTP).1-3

O conceito de lesão de células miocárdicas que ocorrem após uma isquemia / reperfusão (I/R) envolve duas hipóteses principais: aumento do cálcio intracelular e / ou acúmulo de espécies reativas de oxigênio (ERO). Este último causando a peroxidação sarcolemal da camada de fosfolipídio celular, que leva à perda da integridade celular e facilita a entrada de cálcio. Durante uma reperfusão, o cálcio entra na mitocôndria como reação a uma variedade de estímulos e pode modular a abertura do mPTP com os seus componentes acessórios.2,4

O NO é um importante modulador do tonus vascular. Danos funcionais no endotélio devido à formação de peroxinitrito são o resultado da combinação de ERO com NO. Este composto tóxico pode resultar no início da morte celular apoptótica.5 Estudos anteriores revelaram que o extrato de vinho tinto e tratamento antioxidante melhoraram significativamente a função pós-isquêmica ventricular e contrátil.6,7 Para reduzir a lesão letal de reperfusão, novas estratégias cardioprotetoras, incluindo o pré-condicionamento com antioxidantes e inibidores da mPTP,8 têm sido aplicados. Um dos mecanismos fundamentais envolvendo a abertura dos canais de K+ sensíveis ao ATP (K+ATP) nas mitocôndrias resulta no bloqueio do colapso induzido pela isquemia da mPTP e, assim, leva à preservação da função mitocondrial e ATP celular.8,9

Estudos anteriores demonstraram que o ácido gálico, um metabólito do propil galato, melhora o status antioxidante e protege o coração e a membrana dos lisossomos contra o estresse oxidativo induzido pelo isoproterenol em ratos.10 Além disso, a perfusão de polifenol (-) - epigalocatequina galato (EGCG) durante a isquemia reduziu significativamente o tamanho do infarto (50%) após a reperfusão. Deve-se notar que os canais mitocondriais de K+ATP desempenharam um papel crucial na cardioproteção induzida pelo EGCG.11 O tratamento com ácido gálico, mostrado em Ananya (2012), melhorou a cicatrização da úlcera aumentando a razão e-NOS / i-NOS.12 Em outro estudo, o ácido gálico induziu a expressão de eNOS e modulou a vasodilatação e a vasoconstrição dependentes do endotélio.13 A eNOS com papel anti-inflamatório poderia proteger a célula contra lesões I/R através do aumento da produção de NO.13

No entanto, levantamento da literatura mostrou que não há relatos científicos disponíveis sobre os efeitos antioxidantes do ácido gálico sobre os parâmetros hemodinâmicos ou expressão NOS após a lesão I/R.

Além disso, descobriu-se que a inibição da mPTP pela ciclosporina A preservou a morfologia mitocondrial após isquemia/reperfusão miocárdica, limitou a necrose e a apoptose miocitárias e reduziu o tamanho do infarto (60%).14

De acordo com os factos descritos, a abertura da mPTP induzida pelo stress oxidativo desempenha um papel crucial na lesão letal de perfusão que é uma pedra angular na cardioprotecção. O principal objetivo deste estudo foi, portanto, investigar o efeito da combinação de ácido gálico como um poderoso antioxidante e da ciclosporina A como inibidor de mPTP na disfunção hemodinâmica cardíaca, no tamanho do infarto e na expressão de NOS após isquemia/reperfusão no coração isolado de ratos.

Material e Métodos

Aprovação ética

Os protocolos e procedimentos do presente estudo foram aprovados pelo comitê de utilização e cuidado de animais da Ahvaz Jundishapur University of Medical Sciences (AJUMS.REC.1392.222).

Animais

Os experimentos foram conduzidos em noventa ratos machos Wistar pesando (250-300 g) obtidos de casa de animais da Universidade de Ciências Médicas Ahvaz Jundishapur, Ahwaz, Irã. Os animais foram divididos aleatoriamente nos seguintes 9 grupos (Tabela 1). Em cada grupo foram escolhidos 10 ratos utilizando a fórmula de Cochran. Diferentes doses de ácido gálico foram dissolvidas em soro fisiológico e administradas uma vez por dia durante 10 dias por via oral através de uma agulha de gavagem.10 Todos os grupos foram mantidos sob as mesmas condições (temperatura controlada 22 ± 2ºC, com um ciclo de luz escura de 12 h fornecido com alimento e água ad libitum).

Tabela 1 Grupos de animais que foram utilizados neste estudo (n = 10) 

Grupos1 Ácido gálico
(mg/kg)
Ciclosporina
(µM)
Placebo2
C1 Ca
Cb
Salina
Salina
0
0,2
G1 G1a
G1b
7,5
7,5
0
0,2
G2 G2a
G2b
15
15
0
0,2
G3 G3a
G3b
30
30
0
0,2

C: grupos de controle; G: grupos que receberam ácido gálico. Esse grupo não foi exposto a isquemia/reperfusão.

Escolhemos o tamanho da amostra usando a fórmula de Cochran. Com o uso do número de ratos em cada grupo foi____. Mas nós previmos alguns desaparecidos por causa da isquemia. Então, selecionamos 10 ratos em cada grupo.

A fórmula de Cochran foi:

n=Za22S2d2

Drogas

Ácido gálico, ciclosporina A (CsA), heparina, cloreto de 2,3,5-trifenil tetrazólio (TTC), foram adquiridos da Sigma (St. Louis, MO); cloreto de sódio, cloreto de potássio, sulfato de magnésio, hidrogenocarbonato de sódio, hidrogeno-ortofosfato de potássio, D-glicose e cloreto de cálcio foram obtidos de Merck Laboratories, cetamina e xilazina de Alfasan Co (Woderen-Holland).

Isolamento e preparação do coração

Os animais foram anestesiados com Ketamina HCL (50 mg.kg-1), xilazina (2-5 mg.kg-1) e para prevenir a coagulação sanguínea foi injetada heparina (1000 U.kg-1, IP). A traquéia foi canulada e os animais foram ventilados com ar ambiente utilizando um ventilador de roedores (UGO BASILE, modelo: 7025).15 O peito foi aberto e as costelas foram removidas e, em seguida, uma cânula de aço foi colocado na aorta e firmada com uma sutura. O coração foi imediatamente perfundido com solução de Krebs-Henseleit. Em seguida, o coração foi rapidamente excisado e transferido para um aparelho de Langendorff enquanto era continuamente perfundido com a solução a uma pressão (60-70 mmHg) e temperatura (37º constantes (60-70 mmHg) (37°C). Antes de iniciar as experiências, o tampão foi borbulhado com O2-5% de CO2 a 95% para se obter um pH de 7,4.

Um balão de látex cheio de água que foi ligado a um transdutor de pressão por uma agulha de aço inoxidável que foi introduzida através do átrio esquerdo no ventrículo esquerdo para medir a pressão ventricular esquerda (PVE). O coração foi colocado numa câmara de vidro revestida a 37°C de temperatura e abastecido com um período de 25 a 30 min para atingir o equilíbrio antes de qualquer experimento. O volume do balão foi ajustado de forma que a pressão diastólica final do VE (PDF) atingisse 5-10 mmHg.

Utilizou-se um sistema de alimentação de força (Power lab, AD instrument, Australia) para analisar o sinal do transdutor de pressão. A pressão ventricular esquerda desenvolvida (PVED), pressão sistólica ventricular esquerda (PDVE), PDF ventricular, taxa máxima de aumento (+ dp.dt-1 max) e taxa máxima de queda (-dp.dt-1 max) de PVE e o produto de taxa de pressão (RPP, produto de PDVE e frequência cardíaca) e o ângulo II do ECG foram registados. Todos os corações foram perfundidos durante 25-30 min antes da indução de isquemia para permitir a estabilização da PVE e da Pressão de Perfusão Coronária (PPC). Em seguida, eles foram submetidos a uma isquemia global sem fluxo de 30 min, seguida de 60 min de reperfusão.16 A indução bem sucedida da isquemia foi determinada pela elevação do ST no eletrocardiograma. A frequência cardíaca e a pressão de perfusão foram constantemente monitoradas.15 A CsA foi dissolvida em etanol e adicionada a uma solução de perfusão. Após 30 min de isquemia, os corações foram reperfundidos com 0,2 µM de CsA durante 10 min e depois a reperfusão continuou com tampão de solução Krebs-Henseleit comum.17 Os parâmetros cardíacos acima mencionados foram medidos no final da isquemia e a cada 15 minutos durante o período de reperfusão.

Determinação do tamanho do infarto

No final das experiências acima mencionadas, o coração foi cortado em fatias (2 mm de espessura) e incubado com TTC a 1% durante 20 minutos a 37°C de temperatura. Em seguida, as fatias foram incubadas em formalina a 10% durante 60 minutos. E depois, a área do infarto foi medida pelo cálculo da porcentagem da área total de fatia em ambos os lados através da utilização do software de análise de imagem (NIHimagepro.1.16).17

Avaliação da expressão de eNOS e mRNA

As amostras de tecido foram congeladas durante 1 mês. No dia da experimentação, o RNA total foi extraído das amostras de tecido congelado utilizando reagente Trizole (Roche Diagnostics, Indianapolis, IN). A concentração do RNA total foi determinada por espectrofotometria (Bio Photometer Plus, Eppendorf, Hamburgo, Alemanha). Lemos o RNA a 230 e 260 nm. As amostras que estavam em 1,9-2,1 mm foram selecionadas para continuar a avaliação. As outras foram excluídos do estudo.

O cDNA, de acordo com as instruções do fabricante, foi sintetizado a partir de 1 µg do RNA total com o kit Reverse Transcription (Fermentase, Inglaterra).

Foi realizada a transição reversa e reação na cadeia da polimerase (RT-PCR) para determinar os níveis de RNAm (endotelial) (eNOS) das isoformas constituintes e indutíveis da sintase do óxido nítrico (iNOS) no tecido ventricular dos ratos.18

Amplificação de PCR

A solução de PCR continha 10 µl de cADN monocatenário, 5 µl de buffer de PCR 10X, 10 mM MgCl2, 25 Pico mol de ambos sentidos (5_-ACC ACA GTC CAT GCC ATC AC-3_) e antisentido (5_-TCC ACC ACC CTG TTG CTG TA - 3_) primer GAPDH.19 Proporcionou 400 pb de GAPDH, 25 pico mol de ambos sentidos (5_-CGA GAT ATC TTC AGT CCC AAG C-3_) e antisentido (5_-GTG GAT TTG CTG CTC TCT AGG-3_) eNOS primer,19 que produziu 200 pb de eNOS, e 25 Pico mol de sentido (5`CACCTTGGAGTTCACCCAGT3) e antisentido (5 'ACCACTCGTACTTGGGATGC3) iNOS primer,20 que produziu 220 pb de iNOS mensagem, 5U/µl Termophylus Acquaticus (Taq) ADN polimerase (Cinagen, Irán, ) e água até um volume final de 50 µl.

O programa de ciclagem consistiu de incubação a 95°C durante 3 min (eNOS e GAPDH) e a 94°C durante 45s para (iNOS) para ativar a Taq DNA polimerase e 35 ciclos de dois passos com desnaturação a 60°C durante 60s (eNOS e GAPDH) e 60°C para 45s (iNOS) e recozimento/extensão a 72°C por 10 min para todos eles. O modelo de controle negativo (H2O) foi rotineiramente executado em cada PCR. Os produtos de PCR foram executados em electroforese em gel de agarose a 2% e fotografados após coloração com brometo de etídio sob UVlight. Os níveis de expressão de todos os genes foram normalizados contra a expressão de GAPDH (calibrador interno para carga e normalização de molde de RNA iguais). Utilizando um sistema densitométrico computadorizado (Imagem J),18 as bandas no gel foram digitalizadas e quantificadas.

Análise estatística

Os resultados foram analisados utilizando SPSS versão 16 e expressos como Média ± SEM. As comparações entre os grupos foram realizadas utilizando ANOVA de uma via ou ANOVA de medição repetida seguida por teste de comparação múltipla de LSD. Valores de P inferiores a 0,05 foram considerados significativos. A normalidade foi verificada utilizando o teste de Kolmogorov Smirnov. Foram analisadas as alterações hemodinâmicas entre o grupo de controle e outros durante as 2 horas de teste. Este período incluiu o período pré isquemia, isquemia e reperfusão. Durante este tempo registramos as alterações repetidamente. O objetivo principal foi comparar essas alterações entre os grupos controle e tratados. Assim, a comparação dentro de cada grupo não foi realizada.

Resultados

Efeitos do ácido gálico + CsA sobre a função miocárdica

A contratilidade miocárdica (mostrada como ± dp.dt-1) foi diminuída em quase todos os grupos, como mostrado na Tabela 2. Embora o pré-tratamento com ácido gálico (7,5-30 mg.kg-1) sozinho não tenha tido efeitos significativos, a CsA melhorou a contractilidade significativamente comparado com o controle (p < 0,01). No entanto, a combinação de ácido gálico (15 mg.kg-1) e CsA apresentou efeitos de melhora mais significativos na contratilidade (p < 0,001). Também a forma combinada melhorou a contractilidade em comparação com a CsA apenas (p < 0,05) e não teve efeito significativo com ácido gálico sozinho.

Tabela 2 Parâmetro hemodinâmicos durante os períodos de pré-isquemia e reperfusão (60 min após isquemia) do protocolo de isquemia-reperfusão 

Grupo1 +dp/dt -dp/dt PDVE PSVE DP FC FrC
Controle Pré 2 991,2±384 1 615,5±237,5 90±15,1 95.5±15.2 27 989,5±5 499,9 11,2±1 273,7±12,6
Pós 605,6±72,3 291,7±37,4 22,9±2,9 33.3±5.3 4 319,2±394 4,1±0,5 171,2±15,6
G 7,5 Pré 2 342,7±278,9 1 067,4±152,4 68,4±9,1 74±9,1 18 084,8±3 672,1 11,8±1,1 236±10,5
Pós 1 358,3±546,9 504,2±215,6 41,2±14,3 59,5±11,5 8 970,4±3 516,9 6,2±1,5 200,8±21,9
G 15 Pré 2 801,2±312,6 1 242,7±131,5 67,3±5,1 74,2±5,2 19 349,7±1 273,5 11,7±0,8 281,3±9,1
Pós 820,5±134 321,7±59,6 25,2±3,4 37,5±4,2 3 934,6±903,7 5,4±1 152,8±18,3
G 30 Pré 2 367,3±210,8 1 507,9±568,7 64,4±7,9 71,9±7,8 18 409,3±2 323,4 10,3±1 257,7±13,3
Pós 840±141,4 306,9±56,3 39±8,3 51,8±7 6 271,9±2 153,9 5±0,6 151,6±24
CsA Pré 3 036,4±374,5 1 470,2±236,2 82,1±10,2 88,1±9,9 23 409,6±2 442,3 10,4±1,2 292±14
Pós 1 510±319,9** 670±142,1 36,3±7,6 53,5±7,1 8 881±1 623,9 7,6±0.9*
(p=0,006)
210,9±19,1
G 7,5+ CsA Pré 2 477,9±192,7 1 165,6±168,6 66,6±5 72,1±5,7 15 614,3±1 681,6 10,4±1,1 234±16,6
Pós 1 016,6±225,9 402,8±128,8 63,8±7**
(p=0,003)
73,8±20,1*
(p=0,01)
11 486,5±5 450,9*
(p=0,02)
5,3±1,3 193,9±19,6
G 15+ CsA Pré 2 764,9±208 1 614,4±213,5 89,1±13 94±12 23 173,8±3 674,2 10,7±1,2 243,6±9,2
Pós 2 142,1±314,9**, #
(p=0,007)
841,4±109,5*,#
(p=0,03)
54,1±8,3**
(p=0,007)
88,8±10,3**
(p=0,002)
10 063±1 601,6**
(p=0,001)
7,7±1,9**
(p=0,007)
187±17,2
G 30+ CsA Pré 2 554,4±180 1 164,4±123,9 72,5±7 78,9±7,2 20 498±2 285,7 8,6±1 283,2±17,7
Pós 911,3±198,2 327,6±77,4 22,6±4,4 35,8±6,1 4 462±1 050,4 6,5±1,5 186,8±24

1Controle: grupo de controle, G7,5: ácido gálico (7,5 mg / kg), G15: ácido gálico (15 mg / kg), G30: ácido gálico (30 mg / kg) CsA: ciclosporina A, G7,5 + CsA (ácido gálico (7,5 mg / kg) + CsA), G15 + CsA (ácido gálico (15 mg / kg) + CsA), G30 + CsA (ácido gálico (30 mg / kg) + dp / dt: Taxa máxima de aumento da pressão do ventrículo esquerdo, - dp / dt: taxa mínima de aumento da pressão ventricular esquerda, PDVE: pressão desenvolvida ventricular esquerda; PD: produto duplo; FC: fluxo coronariano; FrC: frequência cardíaca; Pre: pré isquemia; post: pós-isquemia.

*p < 0,05: em comparação com controle,

**p < 0,01: em comparação com controle,

*** p < 0,001: em comparação com controle.

#Comparado com CsA sozinho.

Além disso, doses diferentes de ácido gálico ou CsA isoladamente não tiveram efeitos significativos no PDVE, enquanto a administração de ácido gálico (7,5 e 15 mg.kg-1) + CsA melhorou PDVE significativamente (p < 0,05, Tabela 2). O PSVE foi aumentado pelo pré-tratamento de ácido gálico (7,5 e 15 mg.kg-1) em combinação com CsA (p < 0,05); Mas o efeito combinado de 15 mg.kg-1 de ácido gálico + CsA foi mais significativo do que o de pré-tratamento com ácido gálico (7,5 mg.kg-1) + CsA em comparação com o controle (p < 0,01, Tabela 2). Este aumento não foi significativo em comparação com CsA ou gálico sozinho.

O produto de pressão de taxa (RPP) foi diminuído em quase todos os grupos, como mostrado na Tabela 2. Embora o pré-tratamento com ácido gálico (7,5-30 mg.kg -1) sozinho não tenha tido efeitos significativos no PD, a combinação de ácido gálico (15 + CsA mg.kg -1) e CsA melhorou significativamente em comparação com o controle (p < 0,001 ). Neste caso, a comparação de combinações tratamento com CsA ou gálico sozinha não foi significativa.

Fluxo coronário

O fluxo coronariano diminuiu em todos os grupos durante a reperfusão pós-isquêmica em comparação com a pré-isquemia. A administração de ácido gálico (15mg.kg-1) + CsA e CsA melhorou o fluxo coronariano significativamente para o valor pré-isquêmico normal comparado com o controle (Tabela 2). Contudo, outras doses de ácido gálico sozinhas ou numa forma combinada não tiveram efeitos significativos no fluxo coronário em comparação com o controle ou a CsA sozinha. Também o ácido gálico sozinho não teve efeito significativo em comparação com a sua forma combinada.

Frequência cardíaca

No início do experimento, a frequência do coração isolado em todos os grupos não foi diferente entre si (período pré isquemia). No entanto, no final da reperfusão, a frequência cardíaca de todos os grupos foi significativamente reduzida em comparação com o controle (p < 0,05, Tabela 2), mas esta redução não foi significativa em comparação com CsA ou ácido gálico isolado. No entanto, a administração de CsA sozinha aumentou ligeiramente a frequência cardíaca durante os primeiros 60 minutos de reperfusão.

Efeitos do ácido gálico + CsA no tamanho do infarto do miocárdio

O tamanho do infarto do miocárdio foi expresso como a razão percentual da área do infarto para a área total. Esta razão foi de 26,74 ± 2,35% para o grupo controle submetido a 30 min de isquemia e 1h de reperfusão (Figura 1). Apesar do fato de que houve uma redução significativa no tamanho do infarto para aqueles grupos que receberam ácido gálico 15,30mg.kg -1 ou CsA sozinho (p < 0,05, ANOVA unidirecional seguido de LSD), essa redução para esses grupos recebendo ácido gálico (15 ou 30 mg.kg -1 doses) + CsA foi muito mais significativo em relação ao controle (p < 0,001, uma via ANOVA seguida de LSD). Não houve diminuição significativa entre a forma combinada em comparação com CsA ou ácido gálico sozinho.

Figura 1 Efeitos do ácido gálico e/ou ciclosporina A (CsA) no tamanho do infarto do miocárdio (média ± SEM, n = 10) de diferentes grupos de ratos. 

Os animais receberam três doses diferentes de ácido gálico (7,5, 15 e 30 mg / kg) durante 10 dias antes do isolamento do coração e indução de isquemia (30 min) e reperfusão (1 h) sem ou com CsA (0,2 µM, 10 min antes e durante a reperfusão). Os animais de controle receberam solução salina normal como solvente de ácido gálico. O tamanho do infarto do miocárdio é expresso como a relação entre a área do infarto e a área de risco total em percentagem. * Indica diferença significativa com o grupo de controle (* p < 0,05, *** p < 0,001, n = 10 por grupo uma ANOVA seguida pelo teste LSD).

Efeitos do ácido gálico e ciclosporina na expressões eNOS e iNOS mRNA

A análise dos resultados de PCR revelou que a isquemia / reperfusão diminuiu os níveis de expressão de RNAm de eNOS no grupo de controle em comparação com ratos placebo operados, mas a expressão de RNAm de iNOS aumentou no grupo de controle em comparação com sham. Os níveis de RNAm de eNOS foram significativamente aumentados em animais tratados com ácido gálico (G7,5, G15 e G30 mg / kg) ou tratados com CsA (0,2 µM) sozinhos, em comparação com o grupo de controle (p < 0,001; ). Os níveis mais elevados de expressão de mRNA de eNOS foram observados na administração de ácido gálico concomitante e CsA em comparação com controle. (p < 0,001, Figura 2a). A elevação da expressão de RNAm não foi significativa em comparação com CsA ou gálico sozinha.

A expressão de RNAm de iNOS diminuiu significativamente usando ácido gálico (G15 e G30 mg /kg) ou CsA sozinha comparada com a do grupo de controle, contudo a combinação de ambos os fármacos induziu mais redução com doses mais baixas de ácido gálico (G7,5 + CsA, G15 + CsA) (p < 0,001, Figura 2b) e figura suplementar. As alterações mencionadas não foram significativas em comparação com CsA ou gálico isoladamente.

Figura 2 Efeitos do ácido gálico e da ciclosporina nas expressões (a) eNOS e (b) iNOS.Expressão RNAm. 

Os dados foram expressos como a média ± SEM. Os animais receberam três doses diferentes de ácido gálico (7,5, 15 e 30 mg.kg-1) durante 10 dias antes do isolamento do coração e indução de isquemia (30 min) e reperfusão (1 h) sem ou com CsA (0,2 µM, 10 min antes e durante a reperfusão). A análise de resultados de PCR quantitativos revelou que a administração de ácido gálico reduziu a expressão de mRNA de iNOS mas aumentou a de eNOS.

Os dados foram expressos como a média ± SEM. Os animais receberam três doses diferentes de ácido gálico (7,5, 15 e 30 mg.kg-1) durante 10 dias antes do isolamento do coração e indução de isquemia (30 min) e reperfusão (1 h) sem ou com CsA (0,2 µM, 10 min antes e durante a reperfusão). A análise de resultados de PCR quantitativos revelou que a administração de ácido gálico reduziu a expressão de mRNA de iNOS mas aumentou a de eNOS.

Para a descrição de grupos experimentais, veja a legenda da Fig. 2a, e b. Os asteriscos indicam uma diferença significativa. *** p < 0,001 em comparação com o grupo de controle (n = 6).

Discussão

Como esperado, as funções cardíacas tais como contractilidade, DP, fluxo coronariano e PDVE reduziram durante isquemia e reperfusão. Os resultados deste estudo mostraram que embora o pré-tratamento de animais com ácido gálico sozinho, como antioxidante, tenha reduzido o tamanho do infarto, não teve efeitos significativos sobre as funções cardíacas. Além disso, a reperfusão do coração com CsA melhorou parcialmente as funções cardíacas e reduziu o tamanho do infarto. No entanto, a combinação de ambos os fármacos teve efeitos mais significativos no desempenho cardíaco e na redução do tamanho do infarto.

O quarto objeto foi medir o tamanho do infarto. Outros estudos mostraram que este parâmetro aumentou após 3 horas de reperfusão em comparação com 1 hora21 com coloração com TTC. Assim, nós o avaliamos após 1 hora de reperfusão de acordo com os nossos principais objetos de estudo (investigação das alterações durante o início da reperfusão não depois).

Sob condições normais, há um equilíbrio entre a formação de pró-oxidantes e a quantidade de antioxidantes. Durante a I/R, o comprometimento da função miocárdica é atribuído principalmente à interrupção do referido equilíbrio e à elevação da produção de ERO.22 Foi demonstrado que o excesso de ERO poderia levar à formação de peroxinitrito a partir de radicais NO em resposta à sua combinação com ânion superóxido e danificar as células dos tecidos vascular e cardíaco.23 Além disso, a peroxidação lipídica da membrana celular exacerba a depleção da energia celular devido ao dano das enzimas mitocondriais. Além disso, os ácidos nucleicos, a integridade da membrana celular, o retículo sarcoplasmático (SR) e a função de permutador Na + -Ca2 + são danificados, de modo que ocorrem sobrecargas Ca2 + intracelulares e mitocondriais.24 Após estes eventos, o excesso de Ca2 + induz a disfunção das enzimas mitocondriais, despolarização da membrana e abre a mPTP nos miócitos cardíacos.2 Durante a isquemia, devido à interrupção da cadeia de transporte de elétrons (ETC), a produção de ATP é prejudicada e a célula é esgotada de fosfatos de alta energia.25 Após estas lesões, devido ao metabolismo anaeróbio e ao acúmulo de lactato e piruvato, a acidose intracelular é aumentada, e então ocorre o desacoplamento da fosforilação oxidativa que, por sua vez, leva ao inchaço mitocondrial. Este ciclo vicioso leva à morte celular necrótica e disfunção cardíaca.26 Após a abertura da mPTP, o citocromo C é libertado dentro do citosol, interage com o factor 1 de activação da protease da apoptose (APAF-1) e conduz à activação da caspase-9 que activa a caspase 3 que é a chave executora para a sinalização apoptótica.27

Durante os últimos anos, algumas estratégias de proteção cardiovascular foram aplicadas para reduzir as lesões letais de I/R, incluindo pré e pós-condicionamento por antioxidantes, por ativadores da via de quinase de salvamento de lesão por reperfusão (RISK), pela inibição de proteína quinase c-delta e, finalmente, por inibidores de mPTP tais como CsA ou sanglifehrina A.28 Neste estudo, nossa estratégia foi proteger o coração usando antioxidante e impedir a abertura da mPTP. Por meio desta hipótese, a hipótese de que a célula pode ser isolada contra o anteriormente mencionado ciclo vicioso que leva à abertura de mPTP e, em seguida, para a interrupção da produção de ATP.26

Estudos anteriores demonstraram que o ácido gálico poderia melhorar o estado antioxidante através da inibição da peroxidação lipídica e que protege a membrana do coração e do lisossomo contra o estresse oxidativo induzido pelo isoproterenol em ratos.29 Além disso, durante a I/R, a administração de polifenol (-) - epigalocatequina galato (EGCG) reduziu significativamente o tamanho do infarto em 50% e os canais mitocondriais KATP desempenharam um papel crucial na proteção cardio induzida por EGCG.30 Além disso, EGCG inibe a transcrição da óxido nítrico sintase induzível.31 Por outro lado, foi relatado que a inibição da mPTP por CsA manteve a morfologia mitocondrial após a lesão I/R em coelhos e que limitou a necrose miocitária e a apoptose.32

Demonstrou-se que a reperfusão teve alguns efeitos prejudiciais devido à produção de ERO e desordens de PH durante o período de isquemia. Esse fenômeno é dependente do tempo e pode levar à morte celular e lesão miocárdica, que é chamada de "lesão de reperfusão letal".8 Neste estudo, tivemos vários propósitos. O primeiro de nossos objetivos foi investigar a expressão de eNOS durante o tempo inicial de reperfusão. Também outros estudos sugeriram que a expressão de eNOS aumentou dependendo do tempo durante o início da reperfusão (1 hora) e a expressão de iNOS no final dela (3-24 h). Este aumento tem alguns efeitos prejudiciais via produção de NO. O NO reage com os ERO que foram produzidos durante a isquemia e formaram uma grande quantidade de ONOO- que foi levada à apoptose celular.33 A NO tem efeitos bidirecionais: valores moderados têm efeitos protetores, mas um nível alto é prejudicial. O segundo objetivo foi encontrar um dos mecanismos de como os antioxidantes podem melhorar a disfunção hemodinâmica e endotelial através da produção de NO e sua fonte durante a reperfusão precoce (via eNOS protetora).34 Assim, selecionamos uma hora de reperfusão que está relacionada à atividade da eNOS. Terceiro: medimos a atividade enzimática para avaliação de estresse oxidativo e lesão celular por infarto do miocárdio no período de reperfusão imediata, período em que está tipicamente em seu máximo35 e publicamos o resultado, sendo que a maior variação ocorreu durante os primeiros 15 minutos de reperfusão36 e por isso medimos esses parâmetros a cada 15 min como em outros métodos de estudo35 porque a lesão I/R foi agravada pelo tempo e nosso objetivo foi investigar o papel preventivo do inibidor antioxidante ou mPTP e o efeito combinado de ambos durante o tempo total da experiência. Íamos verificar a gravidade da lesão I/R após 60 min de reperfusão quando a produção de NO derivada de eNOS foi afetada pelo pré-tratamento com diferentes doses de antioxidante37,38 sozinho ou combinado com um inibidor de mPTP (CsA). Porque outros estudos mostraram que a inibição da transição de permeabilidade mitocondrial com esta droga pode impedir a expressão de eNOS.39 Concluímos que nosso antioxidante (ácido gálico) modulou a lesão I/R através da produção de NO e este NO foi derivado de eNOS não iNOS. A investigação das alterações hemodinâmicas durante a reperfusão tardia não foi o principal objetivo do nosso estudo.

Apesar de ter observado que o fluxo aumentou de forma insignificante durante a reperfusão nos corações de animais pré-tratados apenas com ácido gálico, concluímos que a sua combinação com CsA teve efeitos mais significativos. A melhora acima mencionada na função cardíaca, observada em nosso estudo, pode ser atribuída aos efeitos antioxidantes do ácido gálico. Parece que o vasculhamento de ERO por ácido gálico já relatado10 poderia proteger as células contra o estresse oxidativo e nitosativo. Além disso, por inibição da produção de nitrito proxy, poderia manter a função do endotélio e o tônus vascular. Estudos anteriores mostraram que o ácido gálico aumentou a expressão da eNOS2. Um aumento na atividade de iNOS e uma diminuição na atividade de eNOS durante a isquemia foram relacionados a lesões de I/R. Nossos resultados mostraram que a expressão de iNOS pós-isquemia no grupo de controle aumentou para 1,6 vezes a do grupo de placebo. O tratamento com ácido gálico ou CsA sozinho elevou a razão original de eNOS / iNOS 2 vezes, mas a combinação de ambos os fármacos foi mais eficiente. É porque a expressão de eNOS dobrou três vezes, usando ácido gálico com CsA, mas a expressão de iNOS foi reduzida para um quarto. Estes resultados correspondem aos de outros pesquisadores que sugeriram o aumento da razão eNOS/iNOS com um análogo do resveratrol.40 Em conjunto, nossos resultados estabeleceram que o NO derivado da eNOS provavelmente modulou o fluxo sanguíneo e este efeito é mais eficiente na combinação de ácido gálico 15 mg / Kg com CsA. Além disso, a expressão de eNOS aumentada pelo uso de todos os compostos poderia ser atribuída a uma maior biodisponibilidade de NO durante a lesão I/R.41 Além disso, nossos resultados revelaram que a contratilidade (±dp.dt-1), RPP, PDVE e frequência cardíaca foram melhoradas nos grupos perfundidos por CsA em combinação com pré-tratamento com ácido gálico. Este efeito pode ser atribuído à preservação da mitocôndria contra ERO, aumentando a capacidade antioxidante com ácido gálico e através da inibição da abertura mPTP por CsA. Assim, o ATP poderia ser mantido na célula e a sobrecarga de Ca2+ foi impedida devido à captação aumentada de Ca2+ para a SR pela ativação da via RISK. Portanto, a interação de elementos contráteis entre si poderia ser melhorada e tornar-se mais rápida.42 No entanto, a utilização da dose mais elevada de ácido gálico (30 mg/kg) inverteu estes efeitos. De acordo com outro estudo, o processo poderia ser explicado por um efeito pró-oxidante do ácido gálico em altas doses, porque provou que o íon férrico poderia quelar o grupo hidroxila na molécula de ácido gálico e reduzir o potencial de oxidação e desse modo perder sua atividade antioxidante.43 Além disso, a contratilidade foi aumentada com CsA sozinha, mas não se recuperou com G7,5+ CsA. Este efeito pode ser explicado com lesões I/R após 1 hora de reperfusão. Porque na reperfusão de 1 hora, a contratilidade diminuiu muito mais do que a reperfusão de 30 minutos, de modo que a lesão se agravou e o efeito protetor da CsA não conseguiu recuperá-lo ao nível de reperfusão de 30 minutos. Por outro lado, ao usar doses mais altas de Gálico (G15+ CsA), o sistema antioxidante fica mais forte e previne a produção de ERO na mitocôndria.26 De fato, é possível que a CsA não possa inibir mais mPTP que foi aberto por ERO produzido devido a lesões de I/R ao longo do tempo.

Alguns dos estudos controlaram a frequência cardíaca com marca-passo. Também esta foi uma variável em nosso estudo. Nós íamos avaliar suas mudanças durante o experimento, então não a controlamos. Devido à comparação dessa variável com o grupo controle, não foi possível fazer um viés neste estudo (todos os grupos foram semelhantes). O objetivo deste trabalho foi investigar as variações dos parâmetros hemodinâmicos afetados pela I/R e pré - tratamento. Assim sendo, a frequência cardíaca foi uma variável que quisemos avaliar por si mesma, sem qualquer intervenção (O uso do marcapasso não satisfez este objetivo). Existem outros estudos que utilizam este método.35

Outros estudos mostraram que o tamanho do infarto aumentou após a reperfusão21 com coloração TTC. Assim, nós o avaliamos durante o início da reperfusão.

Neste estudo, o tamanho do infarto foi significativamente reduzido pelo ácido gálico ou CsA sozinhos (quase 15%), mas esta redução foi mais significativa pela administração concomitante destes dois fármacos (quase 25%). Este efeito pode ser atribuído à ativação de um grupo de proteínas quinases que melhorou a desacoplamento da fosforilação oxidativa e impediu o inchaço das mitocôndrias e a morte celular.44 A inibição de mPTP provocou a ativação das vias antiapoptóticas e RISK e representou um mecanismo de sobrevivência celular programada. Também observamos que a administração de ambos os fármacos melhorou a contratilidade miocárdica mais do que a administração de cada fármaco sozinho.

Já foi reconhecido que a CsA não é apenas um inibidor de mPTP. Também inibe a calcineurina que modula a morte mitocondrial. Enquanto outros estudos relataram que a utilização de FK506, um potente inibidor de calcineurina que é 100 vezes mais potente do que CsA, não afectou a ativação da caspase. Portanto, o papel da CsA no bloqueio dos poros mitocondriais pode ser mais importante do que seus outros papéis. Além disso, outros estudos relataram que o uso de CsA em doses baixas não tem efeitos tóxicos.45 Utilizamos a dose mais baixa de (0,2 µM), muito inferior à de (20 mg.kg-1) utilizada por outros estudos,46 mas pode ser insuficiente para inibir o maior número de mPTP. Por conseguinte, o efeito de doses mais elevadas do inibidor de mPTP que até agora não foi explorado é altamente responsável por aguçar o interesse de investigadores e pesquisadores especializados em estabelecer uma investigação mais minuciosa.

Conclusão

Em conclusão, o uso de ácido gálico como antioxidante concomitante com a preservação da mitocôndria por CsA como inibidor de mPTP em G15 + CsA em comparação com o controle, poderia ter efeitos mais benéficos sobre a disfunção cardíaca, expressões iNOS e NOS endotelial induzidas por lesão I/R .

Limitações do estudo

Tivemos algumas limitações em nosso estudo, por exemplo, nosso financiamento e instalações foram muito limitados. Portanto não pudemos fazer mais experimentos. Por exemplo, não conseguimos fazer qPCR por causa dos recursos e limitação de instrumentos. Então, nos obrigamos a fazer as experiências usando as instalações que estavam disponíveis. Além disso, limitamo-nos a medir a expressão da proteína. Também tivemos limitações para a análise da função e morfologia mitocondriais.

Aprovação ética

Os protocolos e procedimentos do presente estudo foram aprovados pelo comitê de cuidado e uso de animais da Universidade de Ciências Médicas Ahvaz Jundishapur (AJUMS.REC.1392.222).

REFERÊNCIAS

1 Hausenloy DJ, Opie L, Yellon DM. Dissociating HDL cholesterol from cardiovascular risk. Lancet. 2010;376(9738):305-6.
2 Marin-Garcia J, Goldenthal MJ. Heart mitochondria signaling pathways: appraisal of an emerging field. J Mol Med. 2004;82(9):565-78.
3 Hausenloy DJ, Baxter G, Bell R, Botker HE, Davidson SM, Downey J, et al. Translating novel strategies for cardioprotection: the Hatter Workshop Recommendations. Basic Res Cardiol. 2010;105(6):677-86.
4 Marin-Garcia J, Goldenthal MJ. Mitochondria play a critical role in cardioprotection. J Card Fail. 2004;10(1):55-66.
5 Ceconi C, Boraso A, Cargnoni A, Ferrari R. Oxidative stress in cardiovascular disease: myth or fact? Arch Biochem Biophys. 2003;420(2):217-21.
6 Das DK, Sato M, Ray PS, Maulik G, Engelman RM, Bertelli AA, et al. Cardioprotection of red wine: role of polyphenolic antioxidants. Drugs Exp Clin Res. 1999;25(2-3):115-20.
7 Sato M, Ray PS, Maulik G, Maulik N, Engelman RM, Bertelli AA, et al. Myocardial protection with red wine extract. J Cardiovasc Pharmacol.2000 5(2):263-8.
8 Buja LM, Weerasinghe P. Unresolved issues in myocardial reperfusion injury. Cardiovasc Pathol. 2010;19(1):29-35.
9 Yellon DM, Downey JM. Preconditioning the myocardium: from cellular physiology to clinical cardiology. Physiol Rev. 2003;83(4):1113-51.
10 Stanely Mainzen Prince P, Priscilla H, Devika PT. Gallic acid prevents lysosomal damage in isoproterenol induced cardiotoxicity in Wistar rats. Eur J Pharmacol. 2009;615(1-3):139-43.
11 Song DK, Jang Y, Kim JH, Chun KJ, Lee D, Xu Z. Polyphenol (-)-epigallocatechin gallate during ischemia limits infarct size via mitochondrial K(ATP) channel activation in isolated rat hearts. J Korean Med Sci. 2010;25(3):380-6.
12 Chatterjee A, Chatterjee S, Biswas A, Bhattacharya S, Chattopadhyay S, Bandyopadhyay SK. Gallic Acid Enriched Fraction of Phyllanthus emblica Potentiates Indomethacin-Induced Gastric Ulcer Healing via e-NOS-Dependent Pathway. Evid Based Complement Alternat Med. 2012;2012:487380.
13 Sanae F, Miyaichi Y, Hayashi H. Endothelium-dependent contraction of rat thoracic aorta induced by gallic acid. Phytother Res.2003;17(2):187-9.
14 Leshnower BG, Kanemoto S, Matsubara M, Sakamoto H, Hinmon R, Gorman JH 3rd, et al. Cyclosporine preserves mitochondrial morphology after myocardial ischemia/reperfusion independent of calcineurin inhibition. Ann Thorac Surg. 2008;86(4):1286-92.
15 Klawitter PF, Murray HN, Clanton TL, Angelos MG. Reactive oxygen species generated during myocardial ischemia enable energetic recovery during reperfusion. Am J Pysiol Heart Circ Physiol.2002;283(4):H1656-61.
16 Kinugasa Y, Ogino K, Furuse Y, Shiomi T, Tsutsui H, Yamamoto T, et al. Allopurinol improves cardiac dysfunction after ischemia-reperfusion via reduction of oxidative stress in isolated perfused rat hearts. Circ J. 2003; 67(9):781-7.
17 Xie JR, Yu LN. Cardioprotective effects of cyclosporine A in an in vivo model of myocardial ischemia and reperfusion. Acta Anaesthesiol Scand. 2007;51(7):909-13.
18 Mard SA, Neisi N, Solgi G, Hassanpour M, Darbor M, Maleki M. Gastroprotective effect of NaHS against mucosal lesions induced by ischemia-reperfusion injury in rat. Dig Dis Sci. 2012;57(6):1496-503.
19 Di Napoli P, Di Giovanni P, Gaeta MA, Taccardi AA, Barsotti A. Trimetazidine and reduction in mortality and hospitalization in patients with ischemic dilated cardiomyopathy: a post hoc analysis of the Villa Pini d'Abruzzo Trimetazidine Trial. J Cardiovasc Pharmacol.2007;50(5):585-9.
20 Chun TY, Bloem LJ, Pratt JH. Aldosterone inhibits inducible nitric oxide synthase in neonatal rat cardiomyocytes. Endocrinology. 2003;144(5):1712-7.
21 Ito WD, Schaarschmidt S, Klask R, Hansen S, Schäfer HJ, Mathey D, et al. Infarct Size Measurement by Triphenyltetrazolium Chloride StainingVersus In VivoInjection of Propidium Iodide. J Mol cell Cardiol.1997;29(8):2169-75.
22 Cui J, Juhasz B, Tosaki A, Maulik N, Das DK. Cardioprotection with grapes. J Cardiovasc Pharmacol. 2002;40(5):762-9.
23 Falk JA, Aune SE, Kutala VK, Kuppusamy P, Angelos MG. Inhibition of peroxynitrite precursors, NO and O2, at the onset of reperfusion improves myocardial recovery. Resuscitation. 2007;74(3):508-15.
24 Zweier JL, Talukder MA. The role of oxidants and free radicals in reperfusion injury. Cardiovasc Res. 2006;70(2):181-90.
25 Territo PR, Mootha VK, French SA, Balaban RS. Ca(2+) activation of heart mitochondrial oxidative phosphorylation: role of the F(0)/F(1)-ATPase. Am J Physiol Cell Physiol. 2000;278(2):C423-35.
26 Kim JS, Jin Y, Lemasters JJ. Reactive oxygen species, but not Ca2+ overloading, trigger pH- and mitochondrial permeability transition-dependent death of adult rat myocytes after ischemia-reperfusion. Am J Physiol Heart Circ. 2006;290(5):H2024-34.
27 Kim JS, Qian T, Lemasters JJ. Mitochondrial permeability transition in the switch from necrotic to apoptotic cell death in ischemic rat hepatocytes. Gastroenterology. 2003;124(2):494-503.
28 Yellon DM, Hausenloy DJ. Myocardial reperfusion injury. N Engl J Med. 2007;357(11):1121-35.
29 Priscilla DH, Prince PS. Cardioprotective effect of gallic acid on cardiac troponin-T, cardiac marker enzymes, lipid peroxidation products and antioxidants in experimentally induced myocardial infarction in Wistar rats. Chem Biol Interact. 2009;179(2-3):118-24.
30 Song DK, Jang Y, Kim JH, Chun KJ, Lee D, Xu Z. Polyphenol (-)-epigallocatechin gallate during ischemia limits infarct size via mitochondrial K(ATP) channel activation in isolated rat hearts. J Korean Med Sci.1997;25(3):380-6.
31 Lin YL, Lin JK. (-)-Epigallocatechin-3-gallate blocks the induction of nitric oxide synthase by down-regulating lipopolysaccharide-induced activity of transcription factor nuclear factor-kappaB. Mol Pharmacol. 1997;52(3):465-72.
32 Leshnower BG, Kanemoto S, Matsubara M, Sakamoto H, Hinmon R, Gorman Iii JH, et al. Cyclosporine preserves mitochondrial morphology after myocardial ischemia/reperfusion independent of calcineurin iinhibition. Ann Thorac Surg. 2008;86(4):1286-92.
33 Xuan YT, Tang XL, Qiu Y, Banerjee S, Takano H, Han H, et al. Biphasic response of cardiac NO synthase isoforms to ischemic preconditioning in conscious rabbits. Am J Physiol Heart Circ Physiol.2000;279(5):H2360-71.
34 Desrois M, Durrans A, Caus T, Lan C, Clarke K, Cozzone PJ, et al. Modulation of the NO pathway during short or prolonged blood reperfusion following ischaemia in a heterotopic rat heart transplantation model. Transplant Proc.2004;36(5):1280-2.
35 Ray PS, Martin JL, Swanson EA, Otani H, Dillmann WH, Das DK. Transgene overexpression of alphaB crystallin confers simultaneous protection against cardiomyocyte apoptosis and necEROis during myocardial ischemia and reperfusion. FASEB J.2001;15(2):393-402.
36 Badavi M, Sadeghi N, Dianat M, Samarbafzadeh A. Effects of gallic Acid and cyclosporine a on antioxidant capacity and cardiac markers of rat isolated heart after ischemia/reperfusion. Iran Red Crescent Med J. 2014;16(6):e16424.
37 Liang F, Gao E, Tao L, Liu H, Qu Y, Christopher TA, et al. Critical timing of l-arginine treatment in post-ischemic myocardial apoptosis-role of NOS isoforms. Cardiovasc Res. 2004;62(3):568-77.
38 Zhu D-Y, Deng Q, Yao H-H, Wang D-C, Deng Y, Liu G-Q. Inducible nitric oxide synthase expression in the ischemic core and penumbra after transient focal cerebral ischemia in mice. Life Sciences. 2002;71(17):1985-96.
39 López - Ongil S, Hernández - Perera O, Navarro - Antolín J, Perez de Lema G, Rodríguez - Puyol M, Lamas S, et al. Role of reactive oxygen species in the signalling cascade of cyclosporine A - mediated up - regulation of eNOS in vascular endothelial cells. Br J Pharmacol. 1998;124(3):447-54.
40 Guha P, Dey A, Chatterjee A, Chattopadhyay S, Bandyopadhyay SK. Pro-ulcer effects of resveratrol in mice with indomethacin-induced gastric ulcers are reversed by L-arginine. Brit J Pharmacol. 2010;159(3):726-34.
41 Toda N, Toda H. Coronary hemodynamic regulation by nitric oxide in experimental animals: recent advances. Eur J Pharmacol. 2011;667(1-3):41-9.
42 Hausenloy DJ, Ong SB, Yellon DM. The mitochondrial permeability transition pore as a target for preconditioning and postconditioning. Basic Res Cardiol. 2009;104(2):189-202.
43 Shinno E, Shimoji M, Imaizumi N, Kinoshita S, Sunakawa H, Aniya Y. Activation of rat liver micEROomal glutathione S-transferase by gallic acid. Life Sciences. 2005;78(1):99-106.
44 Hausenloy DJ, Yellon DM. Reperfusion injury salvage kinase signalling: taking a RISK for cardioprotection. Heart Fail Rev. 2007;12(3-4):217-34.
45 Hausenloy DJ, Duchen MR, Yellon DM. Inhibiting mitochondrial permeability transition pore opening at reperfusion protects against ischaemia-reperfusion injury. Cardiovasc Res. 2003; 60(3):617-25.
46 Yang CW, Ahn HJ, Han HJ, Kim WY, Li C, Shin MJ, et al. Pharmacological preconditioning with low-dose cyclosporine or FK506 reduces subsequent ischemia/reperfusion injury in rat kidney. Transplantation. 2001;72(11):1753-9.
Política de Privacidade. © Copyright, Todos os direitos reservados.