Mutação em Hetrozigose Composta no Gene da Proteína C Ligante de Miosina e sua Expressão Fenotípica na Cardiomiopatia Hipertrófica

Mutação em Hetrozigose Composta no Gene da Proteína C Ligante de Miosina e sua Expressão Fenotípica na Cardiomiopatia Hipertrófica

Autores:

Julianny Freitas Rafael,
Fernando Eugênio dos Santos Cruz Filho,
Antônio Carlos Campos de Carvalho,
Ilan Gottlieb,
José Guilherme Cazelli,
Ana Paula Siciliano,
Glauber Monteiro Dias

ARTIGO ORIGINAL

Arquivos Brasileiros de Cardiologia

versão impressa ISSN 0066-782Xversão On-line ISSN 1678-4170

Arq. Bras. Cardiol. vol.108 no.4 São Paulo abr. 2017

https://doi.org/10.5935/abc.20170045

Resumo

A cardiomiopatia hipertrófica (CMH) é uma doença autossômica dominante causada por mutações em genes que codificam as proteínas dos sarcômeros. É a principal causa de morte súbita cardíaca em atletas jovens de alto nível. Estudos têm demonstrado um pior prognóstico associado a mutações específicas. A associação entre genótipo e fenótipo em CMH tem sido objeto de diversos estudos desde a descoberta da origem genética dessa doença.

Este trabalho apresenta o efeito de uma mutação composta em MYBPC3 na expressão fenotípica da CMH.

Uma família na qual um jovem tem o diagnóstico clínico de CMH foi submetida à investigação clínica e genética. As regiões codificadoras dos genes MYH7, MYBPC3 e TNNT2 foram sequenciadas e analisadas.

O probando apresenta uma manifestação maligna da doença e é o único em sua família a desenvolver CMH. A análise genética pelo sequenciamento direto dos três principais genes relacionados à essa doença identificou uma variante em heterozigose composta (p.E542Q e p.D610H) em MYBPC3. A análise da família mostrou que os alelos p.E542Q e p.D610H tem origem paterna e materna, respectivamente. Nenhum familiar portador de um dos alelos variantes manifestou sinais clínicos de CMH.

Sugerimos que a expressão heterozigótica bialélica de p.E542Q e p.D610H pode ser responsável pelo fenótipo severo da doença encontrada no probando.

Palavras-chave Cardiomiopatia Hipertrófica; Genes Sarcoméricos; Mutação Composta; MYBPC3

Abstract

Hypertrophic cardiomyopathy (HCM) is an autosomal dominant genetic disease caused by mutations in genes encoding sarcomere proteins. It is the major cause of sudden cardiac death in young high-level athletes. Studies have demonstrated a poorer prognosis when associated with specific mutations. The association between HCM genotype and phenotype has been the subject of several studies since the discovery of the genetic nature of the disease.

This study shows the effect of a MYBPC3 compound variant on the phenotypic HCM expression.

A family in which a young man had a clinical diagnosis of HCM underwent clinical and genetic investigations. The coding regions of the MYH7, MYBPC3 and TNNT2 genes were sequenced and analyzed.

The proband present a malignant manifestation of the disease, and is the only one to express HCM in his family. The genetic analysis through direct sequencing of the three main genes related to this disease identified a compound heterozygous variant (p.E542Q and p.D610H) in MYBPC3. A family analysis indicated that the p.E542Q and p.D610H alleles have paternal and maternal origin, respectively. No family member carrier of one of the variant alleles manifested clinical signs of HCM.

We suggest that the MYBPC3-biallelic heterozygous expression of p.E542Q and p.D610H may cause the severe disease phenotype seen in the proband.

Keywords Hypertrophic cardiomyopathy; sarcomere genes; compound variant; MYBPC3 gene

Introdução

A cardiomiopatia hipertrófica (CMH) é um transtorno miocárdico genético caracterizado por hipertrofia ventricular (HV), frequentemente assimétrica no septo interventricular e que pode levar a uma obstrução dinâmica da via de saída do ventrículo esquerdo (VE).1 É a principal causa de morte súbita cardíaca (MSC) em jovens, com uma mortalidade anual de 2-4% em adultos e 6% em adolescentes e crianças.2 Um resultado benigno da CMH também pode ocorrer, como início tardio, hipertrofia leve e histórico sem eventos malignos.3 Genes modificadores, influências ambientais, diversidade de variantes genéticas e o efeito de múltiplas variantes poderiam explicar a grande heterogeneidade clínica entre indivíduos de uma mesma família ou de famílias diferentes.4

A CMH é um distúrbio mendeliano relativamente comum (0,2%), causado principalmente por mutações nos genes das proteínas do sarcômero, mais comumente aqueles que codificam a cadeia pesada da β-miosina (MYH7), a proteína C ligante de miosina (MYBPC3) e a troponina T (TNNT2).5 Estudos recentes sugerem que essa prevalência é ainda maior, em torno de 1: 200 na população em geral,6 e cerca de 5% daqueles que têm CMH possuem mais de uma variante genética causadora da doença.7-9 A hipótese de efeitos da dosagem gênica em pacientes com múltiplas variantes é sustentada por alguns autores que relataram quadro clínico mais grave, com maior risco de MSC, maior hipertrofia do VE e início mais precoce da CMH.7,10

Neste contexto, apresentamos aqui um caso no qual uma variante em heterozigose composta conduz à uma manifestação da CMH com exacerbação do fenótipo da doença.

Métodos

Amostra

O probando com diagnóstico clínico de CMH foi encaminhado para análise genética no Instituto Nacional de Cardiologia - INC, no Rio de Janeiro. Uma árvore genealógica, incluindo o maior número de gerações possíveis, foi construída com base em sua história familiar. Os membros da família foram submetidos a avaliações clínicas e investigações genéticas. O comitê de ética local aprovou este estudo. Obteve-se consentimento informado por escrito para cada membro avaliado da família.

Avaliação clínica

O probando foi submetido a exame clínico e cardiovascular, incluindo eletrocardiograma de 12 derivações (ECG), ecocardiograma transtorácico (ETT) e monitoramento de 24h por Holter. O diagnóstico de CMH foi baseado no ETT: os principais critérios diagnósticos do ecocardiograma foram definidos por uma espessura máxima diastólica final do VE ≥ 15 mm. O mesmo exame clínico foi realizado para as análises fenotípicas de todos os membros da família, e a ressonância magnética cardíaca (RMC) foi solicitada como exame complementar.

Foi utilizado um escore de risco proposto pela European Cardiac Society (ESC) para prever o risco de MSC em cinco anos para os pacientes com CMH.11

Análise genética

Sequenciamento de Sanger

A análise genética do probando foi realizada através do sequenciamento direto de três genes do sarcômero: MYH7, MYBPC3 e TNNT2. O DNA genômico obtido de leucócitos, de acordo com Miller et al.,12 foi submetido à reação em cadeia da polimerase (PCR) de todos os exons codificadores, utilizando primers previamente descritos e outros projetados por nós (Tabelas 1, 2 e 3), e o mesmo programa de amplificação. Os produtos da PCR foram purificados com EXOSAP-IT (Affymetrix, Santa Clara, CA), submetidos à reação de sequenciamento utilizando o reagente BigDye® Terminator v3.1 (Thermo Fisher Scientific, Waltham, MA) e subsequentemente analisados em um analisador genético ABI 3500xL (Thermo Fisher Scientific, Waltham, MA). As análises de sequências foram realizadas utilizando-se o pacote de software Geneious® v.6.1.6 (Biomatters, Auckland, NZ). A família foi submetida a um teste de mutação específica de acordo com a declaração de consenso de especialistas HRS/EHRA.13

Tabela 1 Primers para o sequenciamento do MYH7 

Forward Primer 5'-3' Reverse Primer 5'-3' Amplicon A.T.
3 TCTTGACTCTTGAGCATGGTGCTA TCTGTCCACCCAGGTGTACAGGTG 381 bp 62ºC
4 AGGAAGGAGGGAAAGCCCAGGCTG TCTGCATGCACTCAATCTGAGTAA 380 bp 62ºC
5 ATCTTTCTCTAACTCCCAAAATCA ACTCACGTGATCAGGATGGACTGG 398 bp 60ºC
6 TGTCACCGTCAACCCTTACAAGTG GAGGCTGAGTCTATGCCTCGGGG 394 bp 62ºC
7 CTTGCTGGTCTCCAGTAGTATTGT CTGCGGTACAGGACCTTGGAGGGC 198 bp 62ºC
8 GCCCTCCAAGGTCCTGTACCGCAG GTCCAAGTCCCAAGGCCAAGGTCA 200 bp 62ºC
9 GACAACTCCTCCCGCTTCGTG AACAGAGGGAGGGAGGGGAGAG 281 bp 62ºC
10 CCTTTTGCTTGCTACATTTATCAT GCCACAAGCAGAGGGGACCAG 252 bp 60ºC
11 CTGCTTCCTCAGGCCATGTGCTGT ACCAATGGCCAGAGTCTTAGCTCT 284 bp 62ºC
12 CACAGGGATTAAGGAGACAAGTTT TTACAGCTGCCCCAAGAATC 273 bp 58ºC
13 AGTCATCTCTTTACCAACTTTGCTA ATTATCATCTGAAGATGGACCCACC 186 bp 62ºC
14 CAAGTTCACTCTTCCCAACAACCCT ATGTGGGAGCGAGTGAGTGATTGTT 258 bp 62ºC
15 ACTCACACCCACTTTCTGACTGCTC GAATTCAGGTGGTAAGGCCAAAGAG 247 bp 62ºC
16 ATAACTGTACTCAGAGCTGAGCCTA TCCATCCCACTGAGTCTGTAAACCT 578 bp 62ºC
17 GCAAATGCCAGCAAGGATGTAAAG AGAGAAGGGAGATGGGAAGTAA 359 bp 58ºC
18 CATCTCTGTGACTTCTCGAATTCT CACTGTGGTGGTAGGTAGGGAGAT 300 bp 60ºC
19 ACAAAGCCAGGATCAGAACCCAGA GTCCAGAGTCACCCATGCTCTGCA 323 bp 62ºC
20 TGGGTATGAGGGTGCACCAGAGCT GCATCAGAGGAGTCAATGGAAAAG 330 bp 62ºC
21 TAGGCTGTTACCCTTCCTAAGGTA GCCTCTGACCCTGTGACTGCAGTG 374 bp 62ºC
22 GGACCTCAGGTAGGAAGGAGGCAG TGTGCAGGGAGGTGCAGGGTTGTG 390 bp 62ºC
23 TCCTATTTGAGTGATGTGCCTCTC ATGGTCTGAGAGTCCTGATGAGAC 390 bp 62ºC
24 AGATGGCACCAAGCTGGTGACCTT TCTGGGCACAGATAGACATGGCAT 290 bp 62ºC
25 GGCAATCTCACAGTCCCCTAATAA TTTTTGCCAGGGAGGACCATCTAA 508 bp 60ºC
26 ACTCTTTACCTGTATCATTACCAT GCCTCCATGGACACATAATCAGTT 306 bp 60ºC
27a* AGCCGAGAGCCTTTTAGAGCCG GTCCCGCCGCATCTTCTGGA 274 bp 64ºC
27b* TCCAGAAGATGCGGCGGGAC AGGGGAGGTGGGAGGAGGAAGT 266 bp 64ºC
28 TCCCACTTCCCTTCCTCTGCCT CAGCACTCCTCTCTATCCCCACCT 438 bp 56ºC
29 GGTGGGGATAGAGAGGAGTGCTGA TGTGGCAGGGTTTGGGCTGT 315 bp 64ºC
30 GAGAAGGGCAAGGGTGGGGT CCTGAGAGGAGAAGGAGGTGGG 422 bp 58ºC
31 TTGTCCCCATCCACACCCTCCA GCTCCGACTGCGACTCCTCATACT 469 bp 56ºC
32 GCTGAAGAGTGAGCCTTGTCCC TCCGCTGGAACCCAACTGCT 396 bp 56ºC
33 AGTATGAGGAGTCGCAGTCGGA GGGGATGAGAACAGGGAGCCAA 500 bp 60ºC
34 CTGCCCTGTGCCCTGACTGT CCAGCCTCGGTTCCCTTCACT 500 bp 64ºC
35 GTGAAGGGAACCGAGGCTGGC GTTGGGCAGAGCAGGAAAAGCA 364 bp 62ºC
36 TCCGTGCCAACGACGACCTGAA GTCCTCACACACTTGCTGCCCA 497 bp 60ºC
37 TGGGCAGCAAGTGTGTGAGGA GGTTGTCACTGTGGCTATGGTGC 391 bp 62ºC
38 / 39 ACCTTCTATGACTGTGCCATCTTCAC GTTTGAGGGTGCTCTGTCTGG 464 bp 62ºC
40 ATGCCCTGTCCCTGCCCAATAC TTTCCACCTCCCCTATGCCAGACC 268 bp 60ºC

(*)Necessário mais de um par de primers para cobrir o exon;

(†)Tamanho do fragmento amplificado;

(‡)Temperatura de anelamento.

Tabela 2 Primers para o sequenciamento de MYBPC3 

Exon Forward Primer 5'-3' Reverse Primer 5'-3' Amplicon* A.T.
2 GACCTCAGCTCTCTGGAATTCATC GCTCAGAGGCCACGTCCTCGTCAA 311 bp 62ºC
3 GTGCACGCTCCAACCAG CAGCAAAGGCAAGAAAGTGTG 429 bp 65ºC
4 CTGGGACGGGGAGGAGAATGTG GCTTTTGAGACCTGCCCTGGAC 385 bp 62ºC
5 GGGCACCTGCGGTCCCAGCTAACT ACGCGGGCTGAGAAGGTGATG 378 bp 62ºC
6 CTACCCCTGGAGCCCCCGATGACC TGCCTCCCAGATTCCCCACACC 449 bp 62ºC
7 CTGGAGCTCCTGGTCTTATGTGAT GGAGCCGTGACACCAAGATGATAA 528 bp 62ºC
8 GCTTCTCAAACGGCCCCCTCTG AGCTCCGCCCCGCAAATCATCC 213 bp 62ºC
9 GGGCTGGGGATGATTTG GGAGGGAGAAAGGGACACTA 226 bp 63ºC
10 AATCTGGCTAGTGTCCCTTTCTCC AGCCCTTTAACTCCTTCCACACTG 322 bp 62ºC
11 TCGGCCCAACTGACTTA CCCATGGGCCTTTACTT 389 bp 58ºC
12 CGGCTCCCCACGGACAG CCCAGGCCAGGCAGGACT 405 bp 67ºC
13 TCCCCAGCCCCTCTTCA GCCGGACTCCGCTCTTT 515 bp 62ºC
14 GGCGGCACAGAGGGGATTG ACCGGCAGGAGCAAAAGGATG 402 bp 62ºC
15 ATCCGGCTGACCGTGGAACT CAGTGCGCCCCGTGATAATC 375 bp 65ºC
16 AACACTTCAACGGCCCCTTCTG GCCCCCTCCTCCGATACTTCACAC 451 bp 62ºC
17 CGGACGACGCAGCCTACCAGT GTCAGCTCCACCCCGTCCTTCA 366 bp 62ºC
18 GGAGGAGGGGGCGCAAGTCAAAT GTCAAAGGCCCAAGGTCACAGAGG 400 bp 62ºC
19 ACAGGCACACGTGTTTTCAC CAGTCTCCACCTGTCCCATC 345 bp 61ºC
20 AGAATACCAACAAGCCAGGACAAG GCGGGAAAGTGAGCAGAACC 402 bp 62ºC
21 TGCCTTTGCCCCCGTGCTACTTG GCCCCAGGACCCCCACTTTTGAT 187 bp 62ºC
22 TCCTCCTGGCTCTCCCGTTTCTCT GCGCCCCTCTGCTGCTTCTTC 379 bp 62ºC
23 GCTCCTCTGCTCCCTACTTCC ATGGCCATCAGCACACTTCAC 310 bp 62ºC
24 TCGGTGCCACAGAGATGATTTTGA GGCTGCCCCTCTGTGTTCTCCA 367 bp 62ºC
25 CCTGTGGCGGTTAGTTGG CACCGGTAGCTCTTCTTCTTCTTG 350 bp 62ºC
26 CCGAGGGAAGGTGGTGTGG TCTGTAAAATGCGGCTGAGTATCC 404 bp 62ºC
27 GGAAGTGCCCCCTATGT TCGCACTGCTCAAAGAAG 457 bp 62ºC
28 TCAGAGGAGTGGGCAGTGGGAGTG CTGGGGTGTCAATGGCGGGTCTT 292 bp 62ºC
29 GCCTGGAGTTGCTGTGTTAG GGCTGCCCCTCTTTGGTC 467 bp 62ºC
30 GCGGCCGGCCCTTGGAGT TGGAAAATGTGAGCTGTGGGTTGG 356 bp 62ºC
31 GCATTCAGGCACTTACCAGGTGACG CACGGTGAGGACAGTGAAGGGTAGC 527 bp 60ºC
32 GGCCGCAGCTACCCTTCAC GGCCCCTCTCCCTGTTCC 392 bp 65ºC
33 GGCCTCTCGGTACCAAGTCCTGTC CAACGTCGGGGCCTGTGAGC 232 bp 65ºC
34 GCAGGGCCATGGTACTCACTCTTG CCGCCCGCTCTTCCCATCTC 404 bp 62ºC
35 CACAGTGACATGGCCTCCTCTTCT GCCCCTACAGCCTCCCATTTACT 159 bp 62ºC

(*)Tamanho do fragmento amplificado;

(†)Temperatura de anelamento.

Tabela 3 Primers para o sequenciamento de TNNT2 

Exon Forward Primer 5'-3' Reverse Primer 5'-3' Amplicon* A.T.
2 ACAGCTCATGAGGGGTGGAACTA GTGCTCTGCCTGGGATCTACAACC 376 bp 65ºC
3 / 4 ATGAGAACGGCAGGCCAGGCTAGTG GTTTGCCTCAAGACCCGAGCAACC 506 bp 65ºC
5 GTGGCGGGAGGTAGCCGACAGT TGGGCAATCAATGGTTGAATCTTA 403 bp 65º C
6 TTGACCCAGCGCTTCTCTTGTGTC ACTGGGTGCCACCAATGCAACTTC 449 bp 65º C
7 CCAGTGCCGGGAGGGACTCAC CAGCCCGTGTCCACTGCACCATAC 262 bp 65º C
8 GGATCAGGGGCCCTGCCTGTCCTGACA TCCTCCTCCTCTTTCTTCCTGTTCT 538 bp 62º C
9 GCCAGGCCCTGCCAGAGGTCTT CCCTGGGGGAGGCCTGAAACAG 494 bp 70º C
10 ACGTCCGTGGAGCTGGTTGAAAGT CCCGGCCAATATTGTCTCTTGACT 373 bp 62º C
11 TGGGAGCTACCCTCTCAGAA CACAGCAGCTGGGAATCTCT 369 bp 60º C
12 GTAAACCCGGCTGACTACAG AGCCAGCCCAATCTCTTCAC 258 bp 62º C
13 CAGGGGGTTTGGGGAGGGTTAG GTGGGGCACCTGCTCAGTTCTCT 402 bp 60º C
14 GGAGGGCCCTTTCTTACTGGAC CCGGACCCAGTGAACCAGGAGGAG 207 bp 68º C
15 GCCCCTCCTGACCCTTAACTATCC CGGAGGAGCCAGAGAAGGAAACCT 353 bp 62º C
16 GGGGGTGAAATGTGGGGCGGAGAA GTGTGGGGGCAGGCAGGAGTGGTG 383 bp 62º C

(*)Tamanho do fragmento amplificado;

(†)Temperatura de anelamento.

Previsão de patogenicidade da variante

Os efeitos de mutações missense foram previstos utilizando-se as ferramentas PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/), SIFT/PROVEAN (http://SIFT.jcvi.org/) e PredictProtein (http:/predictprotein.org/home). A5YM48 e Q14896 foram utilizados como sequências de referência para MYBPC3 (UniProtKB).

Resultados

Um paciente de dezessete anos de idade apresentando manifestação clínica de CMH e histórico de síncope foi submetido ao implante de cardioversor-desfibrilador para prevenção primária de síncope. O diagnóstico foi baseado no ETT e mostrou hipertrofia septal assimétrica de curva reversa, de 39 mm de espessura, com função sistólica do VE preservada e fração de ejeção normal do VE (Figura 1). Além disso, também apresentou disfunção diastólica tipo II, gradiente máximo VE/Aorta de 25 mmHg, movimento sistólico anterior da valva mitral, obstrução do trato de saída do VE e aumento do átrio esquerdo (46 mm). O ECG mostrou uma sobrecarga no VE e AE e o Holter de 24h não documentou a presença de taquicardia ventricular. O risco de MSC foi considerado elevado, 7,69%. A análise genética identificou uma variante missense em heterozigose composta, c.1624G>C (p.E542Q) e c.1828G>C (p.D610H) em MYBPC3 (Figura 2). A variante p.E542Q (rs121909374) já foi associada com CMH no ClinVar e no banco de dados Human Gene Mutation Database (HGMD). A análise in silico realizada com PolyPhen-2 prevê essa variante como possivelmente prejudicial, enquanto o SIFT/PROVEAN e PredictProtein classificam essa mutação como tolerável. Por outro lado, a variante p.D610H (rs371564200) é classificada como uma variante de significado incerto (VSI), embora as ferramentas de previsão de patogenicidade classifiquem a p.D610H como provavelmente prejudicial/nociva. Ambas as variantes afetam os resíduos conservados na cadeia polipeptídica (Figura 2).

Figura 1 ETT do probando e RMC da família. A) Imagem do ETT das quatro câmaras cardíacas e aorta revelando a hipertrofia septal de curva reversa. B) Vista do eixo curto paraesternal mostrando a hipertrofia septal. C) Vista do eixo longitudinal paraesternal mostrando o VE e a hipertrofia septal e o átrio esquerdo aumentado. A seta branca mostra o movimento sistólico anterior da válvula mitral. D) Imagem de ETT mostrando a obstrução e a turbulência no trato de saída do ventrículo esquerdo (seta branca). Regurgitação mitral leve no átrio esquerdo é visível. RMC do pai (E), tia (F) e mãe (G) do probando, sem sinais de hipertrofia ou fibrose. RMC na sequência de inversão-recuperação (atraso do realce) no eixo de 4 câmaras (E1, F1, G1), LVSV (E2, F2, G2) e 2 câmaras (E3, F3, G3). AD: átrio direito; VD: ventrículo direito; AE: átrio esquerdo; VE: ventrículo esquerdo; Ao: aorta. 

Figura 2 A) Pedigree mostrando cinco gerações da família materna. O probando é o único membro afetado pela CMH. Os portadores de alelos variantes da família são indicados por E542Q+ e D610H+. B) Eletroferogramas das regiões das variantes missense do gene MYBPC3 do probando. C) Alinhamento de múltiplas espécies da sequência de aminoácidos da proteína C ligante de miosina dos resíduos 538 a 546 e 606 a 614. Os resíduos conservados, ácido glutâmico e ácido aspártico, são indicados por um retângulo. 

O probando é o único membro que manifesta um fenótipo de CMH em sua família. Seu pai foi adotado, de modo que só os ascendentes maternos são conhecidos. O heredograma construído revelou 30 parentes, ao longo de cinco gerações, nos quais ocorreu apenas uma morte inexplicável de uma mulher de 30 anos sem diagnóstico de CMH (Figura 2).14

A genotipagem dos familiares maternos - avó (59 anos), tia (29 anos), tio (35anos) e mãe (39 anos) - detectou a variante p.D610H. Todos os membros da família eram assintomáticos, com ETT e ECG normais, sem evidência de HV. Por outro lado, o alelo p.E542Q foi detectado no pai (40 anos) e em um irmão por parte de pai (8 anos), ambos com resultados normais na avaliação clínica (Tabela 4). A RMC foi realizada na mãe, tia e pai, e resultou em achados normais, especificamente a espessura normal de parede do VE e sem sinais de fibrose (Figura 1).

Tabela 4 Dados de avaliação clínica dos indivíduos 

Epidemiologia ECG TTE
ID Idade (A) Sexo CMH Variante SAE SVE Onda T AN HVE + HVE tipo Forma Max EPVE (mm) GSVE mmHg DSVE DDVE MAS Tamanho AE (mm)
III.8 59 F Não D610H Não Não Não Não Não - - 10 Não Não Não Não 28
IV.2 40 M Não E542Q Não Não Não Não Não - - 9 Não Não Não Não 35
IV.3 39 F Não D610H Não Não Não Não Não - - 9 Não Não Não Não 37
IV.6 29 F Não D610H Não Não Não Não Não - - 8 Não Não Não Não 32
IV.7 35 M Não D610H Não Não Não Não Não - - 8 Não Não Não Não 36
V.1 8 M Não E542Q Não Não Não Não Não - - 7 Não Não Não Não 37
V.2 17 M Sim D610H
E542Q
Sim Sim Sim Sim Septal Curva reversa 39 25 Não Tipo I Não 46

A numeração de identificação (ID) dos indivíduos segue o padrão adotado nos quadros de Pedigree (Figura 2); ECG: eletrocardiograma; ETT: ecocardiograma transtorácico; (A) - anos; CMH: cardiomiopatia hipertrófica; SAE: sobrecarga atrial esquerda; SVE: sobrecarga ventricular esquerda; onda T NA: onda T anormal; HVE+ : hipertrofia ventricular esquerda mostrada por eco; Tipo HVE: tipo de hipertrofia ventricular esquerda; Max EPVE: máxima espessura da parede ventricular esquerda; GSVE: gradiente de saída do ventrículo esquerdo; DSVE: diâmetro sistólico do ventrículo esquerdo; DDVE: diâmetro diastólico do ventrículo esquerdo; MAS: movimento anterior sistólico; Tamanho AE: tamanho do átrio esquerdo.

Discussão

O presente estudo relata o caso de um jovem com CMH grave, portador de uma variante trans em heterozigose composta no gene MYBPC3, com um alelo - p.D610H - herdado da mãe e outro - p.E542Q - herdado do pai.

Indivíduos com apenas uma única variante não apresentaram qualquer fenótipo de CMH. A variante p.E542Q, encontrada nos familiares paternos, está associada à CMH, com prognóstico bom e hipertrofia moderada na parede ventricular, embora poucos estudos citando essa mutação estejam disponíveis.10,15-17 A previsão de patogenicidade do p.E542Q está de acordo com os dados da literatura.18-21

Além disso, a variante p.D610H, identificada nos familiares maternos, também não manifestou qualquer fenótipo de CMH, mesmo no membro mais velho da família investigado (59 anos). A associação entre p.D610H e CMH permanece incerta, apesar do fato de que as ferramentas de previsão de patogenicidade a tenham classificado como provavelmente patogênica. Apenas um único estudo na literatura identificou essa mutação, embora não a tivesse correlacionado com a doença.22

Em geral, uma única mutação heterozigótica para CMH é suficiente para afetar a função miocárdica e levar à hipertrofia, porém os estudos iniciais associaram variantes no gene MYBPC3 com penetrância incompleta, HV leve, baixo risco de MSC e evolução clínica benigna.23-25

Em conclusão, sugere-se que, individualmente, as variantes p.E542Q e p.D610H resultam em leves alterações na estrutura/função da proteína, insuficientes para causar um fenótipo forte. Contudo, a expressão destas variantes em trans pode ser responsável pelo início precoce da doença, um fenótipo clínico mais grave e um risco aumentado de eventos malignos no probando. Em outras palavras, as variantes duplas e compostas por si só não são decisivas para um prognóstico pior da CMH, mas a composição alélica destas variantes pode ser determinante para este desfecho.

Limitações do estudo

O presente estudo investigou os três principais genes da CMH que representam aproximadamente 60-70% dos casos de CMH.5,14 No entanto, vários outros genes já foram associados a esta doença,5,14 os quais ainda não foram investigados.

REFERÊNCIAS

1 Arola A, Jokinen E, Ruuskanen O, Saraste M, Pesonen E, Kuusela AL, et al. Epidemiology of idiopathic cardiomyopathies in children and adolescents. A nationwide study in Finland. Am J Epidemiol. 1997;146(5):385-93.
2 Maron BJ, Olivotto I, Spirito P, Casey SA, Bellone P, Gohman TE, et al. Epidemiology of hypertrophic cardiomyopathy-related death: revisited in a large non-referral-based patient population. Circulation. 2000;102(8):858-64.
3 Niimura H, Patton KK, McKenna WJ, Soults J, Maron BJ, Seidman JG, et al. Sarcomere protein gene mutations in hypertrophic cardiomyopathy of the elderly. Circulation. 2002;105(4):446-51.
4 Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, et al; EUROGENE Heart Failure Project. Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy. Circulation. 2003;107(17):2227-32. Erratum in: Circulation. 2004;109(25):3258.
5 Maron BJ, Ommen SR, Semsarian C, Spirito P, Olivotto I, Maron MS. Hypertrophic cardiomyopathy: present and future, with translation into contemporary cardiovascular medicine. J Am Coll Cardiol. 2014;64(1):83-99. Erratum in: J Am Coll Cardiol. 2014;64(11):1188
6 Semsarian C, Ingles J, Maron MS, Maron BJ. New perspectives on the prevalence of hypertrophic cardiomyopathy. J Am Coll Cardiol. 2015;65(12):1249-54.
7 Kelly M, Semsarian C. Multiple mutations in genetic cardiovascular disease: a marker of disease severity? Circ Cardiovasc Genet. 2009;2(2):182-90.
8 Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ, et al. Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy. J Am Coll Cardiol. 2004;44(9):1903-10.
9 Ingles J, Doolan A, Chiu C, Seidman J, Seidman C, Semsarian C. Compound and double mutations in patients with hypertrophic cardiomyopathy: implications for genetic testing and counselling. J Med Genet. 2005;42(10):e59.
10 Wang J, Wang Y, Zou Y, Sun K, Wang Z, Ding H, et al. Malignant effects of multiple rare variants in sarcomere genes on the prognosis of patients with hypertrophic cardiomyopathy. Eur J Heart Fail. 2014;16(9):950-7.
11 O'Mahony C, Jichi F, Pavlou M, Monserrat L, Anastasakis A, Rapezzi C, et al; Hypertrophic Cardiomyopathy Outcomes Investigators. A novel clinical risk prediction model for sudden cardiac death in hypertrophic cardiomyopathy (CMH risk-SCD). Eur Heart J. 2014;35(30):2010-20.
12 Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215.
13 Ackerman MJ, Priori SG, Willems S, Berul C, Brugada R, Calkins H, et al; Heart Rhythm Society (HRS); European Heart Rhythm Association (EHRA). HRS/EHRA expert consensus statement on the state of genetic testing for the channelopathies and cardiomyopathies: this document was developed as a partnership between the Heart Rhythm Society (HRS) and the European Heart Rhythm Association (EHRA). Europace. 2011;13(8):1077-109. Erratum in: Erratum in: Europace. 2012;14(2):277.
14 Mattos BP, Scolari FL, Torres MA, Simon L, Freitas VC, Giugliani R, et al. Prevalence and phenotypic expression of mutations in the MYH7, MYBPC3 and TNNT2 genes in families with hypertrophic cardiomyopathy in the south of Brazil: a cross-sectional study. Arq Bras Cardiol. 2016;107(3):257-65.
15 Marsiglia JD, Credidio FL, de Oliveira TG, Reis RF, Antunes Mde O, de Araujo AQ, et al. Screening of MYH7, MYBPC3, and TNNT2 genes in Brazilian patients with hypertrophic cardiomyopathy. Am Heart J. 2013;166(4):775-82.
16 Fokstuen S, Munoz A, Melacini P, Iliceto S, Perrot A, Ozcelik C, et al. Rapid detection of genetic variants in hypertrophic cardiomyopathy by custom DNA resequencing array in clinical practice. J Med Genet. 2011;48(8):572-6.
17 Rodríguez-García MI, Monserrat L, Ortiz M, Fernández X, Cazón L, Núñez L, et al. Screening mutations in myosin binding protein C3 gene in a cohort of patients with Hypertrophic Cardiomyopathy. BMC Med Genet. 2010;11:67.
18 Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, et al. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7(4):248-9.
19 Ng PC, Henikoff S. Predicting deleterious amino acid substitutions. Genome Res. 2001;11(5):863-74.
20 Ng PC, Henikoff S. Accounting for human polymorphisms predicted to affect protein function. Genome Res. 2002;12(3):436-46.
21 Choi Y, Sims GE, Murphy S, Miller JR, Chan AP. Predicting the functional effect of amino acid substitutions and indels. PLoS One. 2012;7(10):e46688.
22 Olivotto I, Girolami F, Sciagrà R, Ackerman MJ, Sotgia B, Bos JM, et al. Microvascular function is selectively impaired in patients with hypertrophic cardiomyopathy and sarcomere myofilament gene mutations. J Am Coll Cardiol. 2011;58(8):839-48.
23 Niimura H, Bachinski LL, Sangwatanaroj S, Watkins H, Chudley AE, McKenna W, et al. Mutations in the gene for cardiac myosin-binding protein C and late-onset familial hypertrophic cardiomyopathy. N Engl J Med. 1998;338(18):1248-57.
24 Cardim N, Perrot A, Santos S, Morgado P, Pádua M, Ferreira S, et al. Hypertrophic cardiomyopathy in a Portuguese population: mutations in the myosin-binding protein C gene. Rev Port Cardiol. 2005;24(12):1463-76.
25 Charron P, Dubourg O, Desnos M, Isnard R, Hagege A, Millaire A, et al. Diagnostic value of electrocardiography and echocardiography for familial hypertrophic cardiomyopathy in a genotyped adult population. Circulation. 1997;96(1):214-9.
Política de Privacidade. © Copyright, Todos os direitos reservados.