Mutações no gene da cadeia leve da ferritina em duas famílias brasileiras com síndrome hereditária hiperferritinemia-catarata

Mutações no gene da cadeia leve da ferritina em duas famílias brasileiras com síndrome hereditária hiperferritinemia-catarata

Autores:

Roberta Cardoso Petroni,
Susana Elaine Alves da Rosa,
Flavia Pereira de Carvalho,
Rúbia Anita Ferraz Santana,
Joyce Esteves Hyppolito,
Claudia Mac Donald Bley Nascimento,
Nelson Hamerschlak,
Paulo Vidal Campregher

ARTIGO ORIGINAL

Einstein (São Paulo)

versão impressa ISSN 1679-4508versão On-line ISSN 2317-6385

Einstein (São Paulo) vol.15 no.4 São Paulo out./dez. 2017 Epub 24-Jul-2017

http://dx.doi.org/10.1590/s1679-45082017rc4006

INTRODUÇÃO

Ferritina é uma proteína composta por duas subunidades fundamentais (cadeias leve e pesada), responsável pelo armazenamento de ferro dentro das células. Em condições normais, a concentração sérica de ferritina é utilizada para avaliar os estoques de ferro e também como um marcador de proteínas de fase aguda. A síndrome hiperferritinemia-catarata (SHC) (OMIM 600886) é uma doença autossômica dominante associada a mutações na região 5’UTR do gene da cadeia leve de ferritina (FTL).(1,2) O gene FTL, localizado no cromossomo 19q13, contém quatro éxons e codifica a subunidade leve da proteína ferritina. A região 5’UTR do gene FTL é também conhecida como elemento responsivo ao ferro e, junto de proteínas reguladoras do ferro, participa do mecanismo de regulação da concentração de ferro nas células.(3)

Quando a concentração intracelular de ferro está baixa, a proteína reguladora do ferro se liga a uma sequência específica no elemento responsivo ao ferro, que se dobra, formando uma alça e, assim, evita a translação do RNA mensageiro. Quando o ferro está disponível na célula, ele se liga a uma proteína reguladora do ferro, induz sua dissociação do elemento responsivo ao ferro e permite a translação do RNA mensageiro, para formar a cadeia leve de ferritina.

Algumas mutações específicas no elemento responsivo ao ferro evitam sua ligação à proteína reguladora do ferro, resultando em uma síntese contínua do gene FTL e, consequentemente, em altos níveis de ferritina, sem sobrecarga de ferro.(3)

Os primeiros relatos de caso desta síndrome foram publicados em 1995, por dois grupos, na Itália e França.(4,5) Várias mutações já foram identificadas em famílias de diferentes países,(3) mas sabe-se pouco sobre a doença.

Os pacientes com esta síndrome geralmente apresentam catarata bilateral precoce, devido ao acúmulo de ferritina no cristalino. Os achados laboratoriais mais frequentes nestes pacientes são níveis elevados de ferritina e normais de ferro sérico, e saturação de transferrina.(6) No entanto, muitos destes pacientes são diagnosticados erroneamente como tendo hemocromatose, não são tratados de forma apropriada e são submetidos a procedimentos invasivos desnecessários.(3) Assim, os casos de hiperferritinemia associada a níveis séricos normais de ferro, saturação normal de transferrina e catarata devem ser investigados para SHC através da pesquisa de mutações na região 5’UTR do gene FTL.

Relatamos dois casos de famílias brasileiras que foram examinadas em nosso serviço com suspeita de SHC. Os diagnósticos foram confirmados pelo achado de mutações na região 5’UTR do gene FTL.

RELATO DE CASO

Caso 1

Paciente do sexo masculino, branco, 4 anos, veio para consulta por apresentar fadiga. Investigou-se anemia, e os testes laboratoriais mostraram hemoglobina de 13g/dL e ferritina de 1.300ng/mL. O teste de ferritina foi repetido em diversas ocasiões e em vários laboratórios, e o resultado foi confirmado.

Na investigação de uma mutação no gene HFE para hemocromatose encontrou-se heterozigose para mutação p.C282Y. O resultado da ressonância magnética para investigar a sobrecarga hepática de ferro foi normal. A sorologia para hepatite foi negativa.

O pai do paciente apresentava catarata congênita e já tinha sido operado. Devido à história familiar, o paciente era frequentemente submetido a exames oftalmológicos de rotina. Teve diagnóstico de catarata alguns meses antes. Levantou-se a hipótese diagnóstica de síndrome de hiperferritinemia-catarata e solicitou-se um teste para detectar mutação no gene FTL, para confirmar o diagnóstico.

Realizamos o sequenciamento de Sanger na região 5’UTR do gene FTL (Quadro 1). A mutação c.-168G>A, descrita inicialmente em 1997, foi encontrada neste caso (Figura 1).(7) Realizou-se rastreamento da mutação no pai e no irmão da criança afetada. O pai tinha a mesma mutação, e o irmão apresentou o gene FTL do tipo selvagem.

Quadro 1 Primers utilizados para amplificação e sequenciamento da região 5’UTR da cadeia leve do gene da ferritina 

FTL_e01f: 5’- CTATGTGCTCCGGATTGGTC -3’
FTL_e02r: 5’- CCGAACTCAATCTCCCAGAA -3’

FTL: level de ferritina.

Figura 1 Eletroferograma de três indivíduos testados no primeiro caso, que mostra a troca de base na posição c.-168, de G para A, em indivíduos afetados e no genótipo selvagem, no indivíduo saudável 

Caso 2

Paciente do sexo masculino, branco, 7 anos, foi encaminhado à consulta ao hematologista devido a níveis séricos aumentados de ferritina (1.019ng/mL) e hemoglobina de 12g/dL, que foram achados incidentais (o paciente estava assintomático). História familiar de catarata congênita pelo lado materno da criança. A saturação de transferrina era 22%. A pesquisa para mutação da hemocromatose foi negativa, assim como o teste para hepatite. O sequenciamento da região 5’UTR do gene FTL demonstrou a presença da mutação c.-164C>G (Figura 2), descrita pela primeira vez em 2003.(2) O paciente foi encaminhado para avaliação oftalmológica, quando foi diagnosticada a catarata congênita. O paciente permanece em acompanhado com o especialista.

Figura 2 Eletroferograma do segundo paciente e de sua mãe, ambos afetados, demonstram a mesma mutação na região c.-164 do gene cadeia leve de ferritina, no qual ocorre a substituição de C por G 

O rastreamento da mutação foi realizado também na mãe, que tinha hemograma normal e ferritina de 1.280ng/mL. Ela foi operada de catarata aos 40 anos. Encontrou-se também a mutação c.-164C>G no gene FTL da mãe.

DISCUSSÃO

A SHC é uma doença rara, causada por mutações na região 5’UTR do gene FTL. A prevalência da síndrome foi estimada em aproximadamente 1/200 mil na Austrália,(8) mas é desconhecida no Brasil. Suas manifestações clínicas são catarata congênita e hiperferritinemia persistente, não associada à sobrecarga de ferro. Várias doenças frequentes estão associadas à catarata congênita;(5) por isto a pesquisa da mutação no gene FTL é raramente incluída na propedêutica desta doença ocular. A maioria dos pacientes afetados pela síndrome é avaliada pela hiperferritinemia. As mutações no gene HFE associadas à hemocromatose são frequentes em nossa população,(7,9-11) sendo esta a principal hipótese diagnóstica para estes indivíduos. O gene HFE está localizado no 6p22.2 e codifica a proteína da membrana, que controla a absorção de ferro, ao regular a interação do receptor de transferrina com transferrina. As mutações neste gene causam hemocromatose hereditária, um distúrbio genético recessivo, caracterizado pelo aumento da absorção de ferro e graus variáveis de toxicidade orgânica relacionados à sobrecarga de ferro. Vale mencionar que é possível ter mutações concomitantes nos genes FTL e HFE,(12,13) levando a diagnósticos e flebotomias terapêuticas desnecessárias.(13)

Neste trabalho descrevemos dois casos de pacientes não relacionados, com SHC causada por mutações diferentes. A mutação c.-168G>A, também conhecida como Pavia-1, foi descrita em famílias descendentes de italianos, indianos, alemães e holandeses; já a mutação c.-164C>G foi descrita pela primeira vez em uma família de origem italiana, em 2003.(4,5) Até onde temos conhecimento, esta é a terceira mutação descrita em famílias brasileiras.(9,12) O pai do primeiro paciente também apresentava uma mutação heterozigótica composta no gene HFE gene, p.C282Y e p.H63D. Embora este genótipo heterozigoto composto não seja normalmente associado à hemocromatose, ele pode causar sobrecarga de ferro quando associado a outras comorbidades.(14) Portanto, é essencial que todos os clínicos que lidam com sobrecarga de ferro pensem no diagnóstico de SHC para evitar flebotomias terapêuticas desnecessárias.(13)

CONCLUSÃO

Nós documentamos aqui duas famílias brasileiras portadoras de mutações distintas no gene cadeia leve de ferritina associadas ao diagnóstico de síndrome hiperferritinemia-catarata. Relatos deste tipo são necessários, uma vez que a prevalência desta condição é desconhecida em nosso país e o diagnóstico correto é fundamental para que se evite intervenções terapêuticas desnecessárias.

REFERÊNCIAS

1. Camaschella C, Zecchina G, Lockitch G, Roetto A, Campanella A, Arosio P, et al. A new mutation (G51C) in the iron-responsive element (IRE) of L-ferritin associated with hyperferritinaemia-cataract syndrome decreases the binding affinity of the mutated IRE for iron-regulatory proteins. Br J Haematol. 2000; 108(3):480-2.
2. Cremonesi L, Paroni R, Foglieni B, Galbiati S, Fermo I, Soriani N, et al. Scanning mutations of the 5’UTR regulatory sequence of L-ferritin by denaturing high-performance liquid chromatography: identification of new mutations. Br J Haematol. 2003;121(1):173-9.
3. Millonig G, Muckenthaler MU, Mueller S. Hyperferritinaemia-cataract syndrome: worldwide mutations and phenotype of an increasingly diagnosed genetic disorder. Hum Genomics. 2010;4(4):250-62. Review.
4. Girelli D, Olivieri O, De Franceschi L, Corrocher R, Bergamaschi G, Cazzola M. A linkage between hereditary hyperferritinaemia not related to iron overload and autosomal dominant congenital cataract. Br J Haematol. 1995;90(4):931-4.
5. Bonneau D, Winter-Fuseau I, Loiseau MN, Amati P, Berthier M, Oriot D, et al. Bilateral cataract and high serum ferritin: a new dominant genetic disorder? J Med Genet. 1995;32(10):778-9.
6. Bertola F, Veneri D, Bosio S, Battaglia P, Disperati A, Schiavon R. Hyperferritinaemia without iron overload: pathogenic and therapeutic implications. Curr Drug Targets Immune Endocr Metabol Disord. 2004;4(2):93-105. Review.
7. Cazzola M, Bergamaschi G, Tonon L, Arbustini E, Grasso M, Vercesi E, et al. Hereditary hyperferritinemia-cataract syndrome: relationship between phenotypes and specific mutations in the iron-responsive element of ferritin light-chain mRNA. Blood. 1997;90(2):814-21.
8. Craig JE, Clark JB, McLeod JL, Kirkland MA, Grant G, Elder JE, et al. Hereditary hyperferritinemia-cataract syndrome: prevalence, lens morphology, spectrum of mutations, and clinical presentations. Arch Ophthalmol. 2003;121(12): 1753-61.
9. Ferreira AC, Oliveira VC, Caxito FA, Gomes KB, Castro AM, Pardini VC. [Prevalence of C282Y and H63D mutations in the HFE gene of Brazilian individuals with clinical suspicion of hereditary hemochromatosis]. Rev Bras Hematol Hemoter. 2008;30(5):379-83. Portuguese.
10. Herkenhoff ME, Pitlovanciv AK, Remualdo VR. Prevalence of C282Y and H63D mutations in the HFE gene in patients from São Paulo and Southern Brazil. J Bras Patol Med Lab. 2016;52(1):21-4.
11. Assis RA, Kay FU, Conti FM, Campregher PV, Szarf G, Diniz MS, et al. The role of magnetic resonance imaging-T2* in the evaluation of iron overload early in hereditary hemochromatosis. A cross-sectional study with 159 patients. Am J Hematol. 2015;90(12):E220-1.
12. Meneses FG, Schnabel B, Silva ID, Alberto FL, Toma L, Nader HB, et al. Identification of the mutations associated with hereditary hyperferritinemia cataract syndrome and hemochromatosis in a Brazilian family. Clin Genet. 2011;79(2):189-92.
13. Barton JC, Beutler E, Gelbart T. Coinheritance of alleles associated with hemochromatosis and hereditary hyperferritinemia-cataract syndrome. Blood. 1998;92(11):4480.
14. Walsh A, Dixon JL, Ramm GA, Hewett DG, Lincoln DJ, Anderson GJ, et al. The clinical relevance of compound heterozygosity for the C282Y and H63D substitutions in hemochromatosis. Clin Gastroenterol Hepatol. 2006; 4(11):1403-10.
Política de Privacidade. © Copyright, Todos os direitos reservados.