Compartilhar

O Efeito de Hipotireoidismo Fetal na Expressão da Miosina Cardíaca de Cadeia Pesada em Ratos Macho

O Efeito de Hipotireoidismo Fetal na Expressão da Miosina Cardíaca de Cadeia Pesada em Ratos Macho

Autores:

Nasibeh Yousefzadeh,
Sajad Jeddi,
Mohammad Reza Alipour

ARTIGO ORIGINAL

Arquivos Brasileiros de Cardiologia

versão impressa ISSN 0066-782Xversão On-line ISSN 1678-4170

Arq. Bras. Cardiol. vol.107 no.2 São Paulo ago. 2016 Epub 11-Jul-2016

https://doi.org/10.5935/abc.20160099

Resumo

Fundamento:

Deficiência de hormônio da tireoide durante vida fetal pode afetar a função cardíaca no futuro. O mecanismo subjacente dessa ação em hipotireoidismo fetal (HF) em ratos ainda não tem explicação.

Objetivo:

O objetivo desse estudo é avaliar o efeito de HF na função cardíaca em ratos macho e determinar a contribuição da α-miosina de cadeia pesada (α-MCP) e de isoformas β-MCP.

Métodos:

Seis ratos fêmea gestantes foram aleatoriamente divididas em dois grupos. O grupo do hipotireoidismo recebeu água contendo 6-propil-2-tiouracil durante a gestação, e os ratos no grupo de controle receberam água de torneira. Os filhotes dos ratos foram testados quando atingiram idade adulta. O coração dos ratos HF e controle foram isolados e submetidos a perfusão pelo método de Langendorff para medição de parâmetros hemodinâmicos. Também foram medidas as expressões de mRNA do coração de α-MCP e β-MCP por qPCR.

Resultados:

PVED de base (74,0 ± 3,1 vs. 92,5 ± 3,2 mmHg, p < 0,05) e pressão arterial (217 ± 11 vs. 273 ± 6 batidas/min, p < 0,05) mostraram-se mais baixas em ratos HF do que em ratos controle. Além disso, esses resultados mostraram a mesma significância em ±dp/dt. Em ratos HF, a expressão de β-MCP foi mais alta (201%) e a de α-MCP foi mais baixa (47%) do que em ratos controle.

Conclusão:

Deficiência de hormônio da tireoide durante a vida fetal pode enfraquecer funções cardíacas normais em ratos adultos, efeito devido em parte à expressão aumentada de β-MCP em relação a α-MCP no coração.

Palavras-chave: Hipotireoidismo; Feto; Miosinas Cardíacas; Contração Miocárdica; Hormônios Tireoideos; Ratos

Abstract

Background:

Thyroid hormone deficiency during fetal life could affect the cardiac function in later life. The mechanism underlying this action in fetal hypothyroidism (FH) in rats has not been elucidated thus far.

Objective:

The aim of this study is to evaluation the effect of FH on cardiac function in male rats and to determine the contribution of α-myosin heavy chain (MHC) and β-MHC isoforms.

Methods:

Six pregnant female rats were randomly divided into two groups: The hypothyroid group received water containing 6-propyl-2-thiouracil during gestation and the controls consumed tap water. The offspring of the rats were tested in adulthood. Hearts from the FH and control rats were isolated and perfused with langendroff setup for measuring hemodynamic parameters; also, the heart mRNA expressions of α- MHC and β-MHC were measured by qPCR.

Results:

Baseline LVDP (74.0 ± 3.1 vs. 92.5 ± 3.2 mmHg, p < 0.05) and heart rate (217 ± 11 vs. 273 ± 6 beat/min, p < 0.05) were lower in the FH rats than controls. Also, these results showed the same significance in ±dp/dt. In the FH rats, β-MHC expression was higher (201%) and α- MHC expression was lower (47%) than control.

Conclusion:

Thyroid hormone deficiency during fetal life could attenuate normal cardiac functions in adult rats, an effect at least in part due to the increased expression of β-MHC to α- MHC ratio in the heart.

Keywords: Hypothyroidism; Fetus; Cardiac Myosins; Myocardial Contraction; Thyroid Hormones; Rats

Introdução

Estudos anteriores mostraram que muitas das doenças que ocorrem na idade adulta, como diabetes, hiperlipidemia e doenças cardiovasculares, são resultado de restrição de crescimento intra-uterino (RCIU).1 A RCIU pode ser causada por diversos fatores, incluindo desnutrição, estresse e distúrbios endócrinos como alterações na tireoide.2,3

Hormônios da tireoide têm um papel importante no desenvolvimento e crescimento de diversos órgãos durante a vida, especialmente nos períodos fetal e pré-natal.4 Há relatos de que a diminuição dos níveis de hormônios da tireoide durante a vida fetal (hipotireoidismo fetal) em ratos é causadora de RCIU e induz disfunção cardíaca no futuro.5,6 Porém, mecanismos subjacentes ainda não foram compreendidos.

A miosina de cadeia pesada (MCP) é a principal proteína contrátil do tecido cardíaco e principal reguladora da função e contratilidade cardíaca, o que representa duas isoformas MCP: α-MCP e β-MCP.7,8 A proporção das isoformas α-MCP e β-MCP pode variar de acordo com o estágio de desenvolvimento, e mudanças nesta relação prejudicam a contratilidade cardíaca.7 O aumento da expressão de β-MCP no coração, característica comum de insuficiência cardíaca, pode ser induzido por estresse mecânico e hipotireoidismo.9,10

Até onde sabemos, não há relatos documentados que abordem o mecanismo de insuficiência cardíaca em ratos com hipotireoidismo fetal (HF); o objetivo de nosso estudo é, portanto, determinar se mudanças na expressão de genes α-MCP e β-MCP estão envolvidas na disfunção cardíaca em ratos com hipotireoidismo fetal.

Métodos

Animais

Ratos Wistar macho e fêmea foram mantidos num biotério com temperatura de 2 ± 3°C, humidade relativa de 50 ± 6%, e tiveram acesso livre a ração padrão e água de torneira durante o estudo. Os animais foram adaptados a um ciclo de claro/escuro a cada período de 12 horas. Todos os procedimentos empregados, bem como manuseio e cuidados com os ratos, estavam de acordo com diretrizes fornecidas pelo comitê de ética local.

Indução de hipotireoidismo fetal

Seis ratos Wistar fêmeas virgens (pelo corpóreo = 200 ± 10 g) foram mantidas durante a noite com ratos macho (peso corpóreo = 300 ± 20 g) (duas fêmeas e um macho por gaiola) na fase de proestro determinada por esfregaços vaginais para o acasalamento. As fêmeas gestantes foram aleatoriamente dividas em: 1 - Consumo de 0,025% de 6-propil-2-tiouracil (PTU) durante a gestação e 2 - O grupo de mães de controle. Após a divisão, as fêmeas foram transferidas para gaiolas separadas. As mães que consumiram o PTU, tiveram a substância misturada na água durante a gestação (consumo iniciado no primeiro dia da gestação e descontinuado após o parto) e as mães do grupo de controle receberam apenas água de torneira. Após serem desmamados, os filhotes macho das mães foram separados e divididos em dois grupos: HF (n = 8) e controles (n = 8) e foram mantidos em grupos de quatro por gaiola com acesso livre a comida e água. Nesse estudo, os ratos no grupo de controle e HF foram divididos em dois subgrupos, e em seguida foram feitos o estudo funcional e a análise molecular. Após o nascimento, o peso dos filhotes em todos os grupos foi medido mensalmente, do primeiro dia de vida até o final do terceiro mês. Além disso, o ganho de peso até 3 meses de idade foi medido nos grupos controle e HF.

Medições T3 e T4

Para avaliar o status da função da tireoide, amostras de sangue foram obtidas - da mãe após o parto e dos filhotes no dia do nascimento e aos 3 meses de idade - centrifugadas (3000 × g, 10 min a 4°C), e o soro foi armazenado a -80°C até o momento do ensaio. Os níveis de triiodotironina total (TT3) e tiroxina total (TT4) foram medidos por kit ELISA (Pishtazteb Company, Irã). Coeficientes de variação inter e intra- ensaios foram de 3,6 e 4,7% para T3 e 5,8 e 6,3% para T4, respectivamente.

Medição dos parâmetros hemodinâmicos

Todos os ratos aos 3 meses de idade foram anestesiados por injeção intraperitoneal de cetamina e xilazina (60 mg/kg e 10 mg/kg). O coração dos ratos controle e HF foram rapidamente excisados e imerso num tampão de perfusão gelada; aortas foram então canuladas e os corações foram fixados no modo de pressão constante do aparelho de perfusão de Langendorff e perfundidos através da aorta com a solução Krebs-Henseleit (pH = 7,4) contendo (mmol/L): NaCl 118, NaHCO3 25, KCl 4,7, MgCl2 1,2, CaCl2 2,5, KH2PO4 1,2 e glicose 11; A pressão de perfusão da solução foi constantemente ajustada em 75 mmHg e a solução Krebs foi gaseificada com a mistura de 95% O2 e 5% CO2 a 37°C.

Um balão de látex foi inserido no ventrículo esquerdo para permitir a medição da pressão ventricular esquerda desenvolvida (PVED), das taxas de pico de alterações positivas (+dP/dt) e negativas (-dp/dt) na pressão do ventrículo esquerdo e da frequência cardíaca (FC). Parâmetros hemodinâmicos (FC, PVED e ±dp/dt) foram digitalizados por um sistema de Power Lab (AD instrument, Australia).11

Isolamento de RNA, síntese de cDNA e PCR em tempo real quantitativo

O RNA total foi extraído do ventrículo esquerdo dos corações por meio de kit de solução RNX-Plus (Fermentase, Cinagen Co. Irã) de acordo com instruções do fabricante. A quantidade e a pureza do RNA foram medidas por meio do NanoDrop 1000 (Thermo Scientific, Waltham, and Mass). A expressão dos genes α-MCP e β-MCP foram avaliadas quantativamente por reação em cadeia da polimerase em tempo real, sequências de iniciadores para cada gene foram escolhidas com Gene-Runner Software, versão 3.05 (Tabela 1). Para síntese de cDNA, o RNA total foi transcrito de forma inversa por meio de Revert Aid M-MuLV transcriptase reversa, dNTPs, iniciadores hexâmeros aleatórios, DNase I e inibidor de ribonuclease RiboLock, durante 10 min a 25°C, seguido de 60 min a 42°C num volume final de 20 µl. A reação foi terminada pelo aquecimento a 70°C por 5 min.

Tabela 1 Sequências de iniciadores 

Genes Sequência de Iniciadoresa
α-MCP F: GCTGGAGCTGATGCACCTGT
R: TCGGCATCTGCCAGGTTGTC
β-MCP F: TCGGGAAGCAGTGCCAGAAC
R:AGGAGCAGGAAGGGTCGGTT
β-actina F: TACAGCTTCACCACCACAGC
R: ATGCCACAGGATTCCATACC

Sequências derivadas de NCBI (www.ncbi.nlm.nih.gov). MCP: miosina de cadeia pesada.

Uma mistura principal contendo 12,5 µl SYBR PCR verde Master Mix (Fermentase, Germany), 8,5 µl de água e 2 µl de iniciador direto e iniciador reverso num volume final de 25 µl foi preparado para realizar PCR em tempo real. Dois microlitros de cDNA transcrito de forma inversa foram então adicionados à mistura principal PCR para chegar ao volume final de 25 µl. Reações sem padrão foram incluídas como controles negativos.

O protocolo de PCR foi usado no aparelho de PCR em tempo real (Rotor-Gene 3000) em três etapas, incluindo: 1 - desnaturação inicial (10 min a 95°C), 2 - programa de amplificação de três passos (15 s a 95°C seguido de 30 s a 60°C para genes α-MCP e β-MCP, e 30 s a 72°C) repetido 40 vezes, e 3 - análise da curva de fusão (1 ciclo: 72 a 95°C com taxa de transição de temperatura a 1°C/seg por 5 segs). Quantificação em tempo real foi monitorada pela medição do aumento em fluorescência causado pela ligação do corante SYBR verde ao DNA de cadeia dupla ao final de cada ciclo de amplificação. Todos os ensaios foram realizados em duplicado. A quantidade relativa de mRNA para cada gene alvo foi calculada com base ciclo limiar (Ct) comparado ao Ct do gene housekeeping (gene de referência) (β-actina). A quantificação relativa foi feita pelo método 2(-∆ )(∆)( Ct )conforme descrito a seguir:12

2-[( gene alvo Ct - gene de referência Ct) experimental - (gene alvo Ct - gene de referência Ct) controle]. A especificidade das reações PCR foi verificada pela geração de análise da curva de fusão.

Análise estatística

Todos os valores foram expressos como média ± EPM. A análise estatística foi feita por meio do software SPSS (SPSS, Chicago, IL, USA; versão 20). O teste Shapiro-Wilk foi usado para checar a normalidade dos dados estudados e, depois, os testes paramétrico ou não paramétrico foram usados para a análise da distribuição normal ou não-normal de dados, respectivamente.13 Portanto, o teste de amostra t de Student foi usado para comparar níveis de hormônio de tireoide, PVED, FC, ±dp/dt e massa corpórea entre os grupos. O teste de Mann-Whitney também foi usado para comparar a expressão de genes entre os dois grupos. Valores bilaterais de p < 0,05 foram considerados estatisticamente significativos.

Resultados

Os efeitos da administração de PTU nos níveis de hormônio da tireoide durante a gestação (T3 e T4 total) no soro das mães estão demonstrados na Figura 1A. Conforme vemos, as mães que consumiram PTU durante a gestação tiverem T3 e T4 total mais baixo no soro em comparação ao grupo de controle (p < 0,05). T3 e T4 total no soro dos filhotes após administração de PTU em mães gestantes estão demonstrados na Figura 1B e 1C. Na hora do nascimento, os filhotes tinham T3 e T4 total mais baixo no soro em comparação ao grupo de controle (p < 0,05) (Figura 1B), ao passo que na vida adulta (terceiro mês), não foi encontrada diferença significativa entre os dois grupos (Figura 1C).

Figura 1 Concentrações de soro T3 e T4 na mãe (A), neonatos (B) e 3 meses de idade (C) no hipotireoidismo fetal, e ratos controle. Valores são média ± EPM. *p < 0,05, diferenças estatisticamente significativas entre hipotireoidismo e controles em mães e hipotireoidismo e controles em filhotes (n = 8 ratos). T4: Tiroxina; T3: triiodotironina; HF: hipotireoidismo fetal. 

A Figura 2 mostra os efeitos da deficiência do hormônio da tireoide durante a vida fetal no peso corporal (do nascimento aos três anos de idade). Conforme demonstrado, o peso corporal no nascimento estava significativamente mais baixo em ratos HF do que em ratos controle. Além disso, o ganho de peso até 3 meses de idade foi significativamente menor em ratos HF do que em controles.

Figura 2 Peso corporal em ratos com hipotireoidismo fetal e controles. Valores são média ± EPM. *p < 0,05, diferenças estatisticamente significativas entre ratos com hipotireoidismo fetal e ratos controle (n = 8 ratos). HF: Hipotireoidismo fetal. 

Parâmetros hemodinâmicos, incluindo PVED, ±dp/dt e frequência cardíaca nos filhotes (aos 3 meses de idade) que tinham deficiência de hormônio da tireoide durante a vida fetal estão descritos na Figura 3. O nível basal de PVED nos ratos HF estava significativamente mais baixo do que nos ratos controle (Figura 3A) (p < 0,05). Além disso, ratos HF tiveram níveis basais de frequência cardíaca e de +dp/dt e -dp/dt mais baixos do que os controles (Figuras 3B, 3C e 3D, respectivamente) (p < 0,05).

Figura 3 Parâmetros hemodinâmicos no hipotireoidismo fetal e ratos controle. A) Pressão ventricular esquerda desenvolvida (PVED), B) Frequência cardíaca, C) Taxas de pico de mudanças positivas na pressão ventricular esquerda (+dp/dt), D) Taxas de pico de mudanças negativas na pressão ventricular esquerda (-dp/dt). Valores são média ± EPM, (n = 8 ratos), *p < 0,05, diferenças estatisticamente significativas entre ratos com hipotireoidismo fetal e ratos controle. HF: Hipotireoidismo fetal. 

Os efeitos deficiência de hormônio da tireoide durante a vida fetal nas expressões de β-MCP e α-MCP nos filhotes de 3 meses de idade estão demonstrados na Figura 4. Nos ratos HF, a expressão de β-MCP estava mais alta (201%) (Figura 4A) (p < 0,05) e a expressão de α-MCP estava mais baixa (47%) em comparação aos ratos controle (Figura 4B) (p < 0,05).

Figura 4 Expressão de genes em corações de ratos com hipotireoidismo fetal e ratos controle. MCP: miosina de cadeia pesada *p < 0,05. Dados foram normalizados ao calibrador (definido em 1) e apresentados como média ± EPM. HF: Hipotireoidismo fetal. 

Discussão

Nossos resultados mostraram que a deficiência de hormônios da tireoide na vida fetal poderia enfraquecer as funções cardíacas normais, incluindo PVED, FC e ±dp/dt durante a idade adulta. A disfunção cardíaca em ratos HF é, pelo menos em parte, causada pelo aumento da expressão de β-MCP e diminuição da-expressão de α-MCP.

Nesse estudo, ratos HF tiveram menor ganho de peso até os 3 meses de idade, resultado esse coerente com estudos prévios.6,13 Relatos anteriores mostraram que baixo peso de nascimento é um fator de risco para futuras doenças na idade adulta em humanos e animais, incluindo doenças cardiovasculares.2,14,15

Relatos anteriores também demonstraram que funções cardiovasculares podem ser afetadas pela RCIU.5 No presente estudo, o consumo de PTU pelas mães durante o período gestação induziu RCIU nos filhotes. Há relatos de que a deficiência de hormônio da tireoide na vida fetal causa RCIU.6 Resultados desse estudo demonstraram que mães com hipotireoidismo, no momento do parto, e seus filhotes, na hora do nascimento, tinham níveis mais baixos de hormônios da tireoide (níveis T3 e T4 total) em comparação ao controle correspondente. Porém, os níveis desses hormônios mostraram-se normais nos filhotes na vida adulta, indicando que os ratos HF apresentavam deficiência de hormônios da tireoide apenas no período fetal. Estudos prévios indicaram que hormônios da tireoide são necessários para o desenvolvimento e função cardíaca normal durante a vida, especialmente na vida fetal.6,6

Nesse estudo, ratos HF apresentaram níveis basais mais baixos de PVED, ±dp/dt, e de frequência cardíaca em comparação aos controles. Diminuições observadas em PVED, ±dp/dt e também na frequência cardíaca nesse estudo foram similares àquelas observadas em relatos anteriores,6 descobertas que mostram que a deficiência de hormônios da tireoide na vida fetal pode influenciar a função cardíaca normal e induzir disfunção cardíaca nos filhotes adultos. Além disso, relatos anteriores demonstraram que parâmetros hemodinâmicos basais mais baixos e insuficiência cardíaca são desfechos comuns de hipotireoidismo adulto.11,17

Os mecanismos dos efeitos da deficiência de hormônios da tireoide durante a vida fetal no desenvolvimento e função cardíaca na vida adulta ainda não são claramente compreendidos. Neste estudo, mostramos pela primeira vez que a deficiência de hormônios da tireoide na vida fetal está associada ao aumento da expressão de β-MCP [2,11 vezes mais alta (201%) do que no grupo controle]. Não há, contudo, relatos documentados sobre as alterações nas expressões α- e β-MCP em ratos HF; relatos anteriores demonstraram que a indução de hipotireoidismo durante a vida adulta leva a uma mudança de α- para β-MCP.9,10,18 Expressão elevada de β-MCP no tecido cardíaco, aspecto frequente de insuficiência cardíaca, pode diminuir a produção de energia e levar a uma diminuição da função sistólica cardíaca.19 A α-MCP teve rápida atividade de ATPase e maior velocidade de encurtamento das fibras do que β-MCP, portanto a relação α-MCP: β-MCP no coração pode determinar contratilidade cardíaca.20 O hipotireoidismo em ratos adultos leva ao aumento da expressão da β-MCP e velocidade diminuída de encurtamento de fibra e, depois, reduz a contratilidade cardíaca.20,21 Chizzonite e Zak18 relataram que um aumento na α-MCP observado após o nascimento era concordante com aumento expressivo no nível sérico dos hormônios da tireoide.

Entre outros possíveis mecanismos moleculares envolvidos no efeito de HF na função cardíaca, Chizzonite e Zak18 relataram que o hipotireoidismo fetal atrasa a mudança de β-MCP (MCP embrionária em ratos) para α-MCP (MCP adulta em ratos) e causa deficiência cardíaca. Wibo et al.22 também relataram que a maturação do receptor de dihidropiridina (canal de cálcio tipo L voltagem) foi adiada após a indução do hipotireoidismo em ratos em vida fetal e neonatal, e induziu desequilíbrio iônico no tecido cardíaco. Além disso, Meehan e Kennedy23 relataram que a deficiência de hormônios da tireoide na vida fetal diminuía o nível de energia nas células devido à redução na expressão de isoformas de citocromo c oxidase e enzimas vitais para a produção de energia na cadeia de transporte de elétrons no tecido cardíaco durante o período de desenvolvimento. De acordo com resultados desse estudo e relatos prévios, é então possível que a redução da função cardíaca em ratos HF esteja relacionada ao aumento da expressão da relação β- para α- MCP e à desregulação da expressão de isoformas de citocromo c oxidase e receptor de dihidropiridina - todos esses fatores que poderiam contribuir com a potência da função cardíaca.

Em relação às limitações do estudo, os resultados foram limitados a ratos machos, e o hipotireoidismo fetal pode afetar funções cardíacas em ambos os sexos. Além disso, utilizou-se o modelo de coração perfundido pelo método de Langendorff-para a medição da função cardíaca; no entanto, já foi relatado que o uso de modelo in vivo é clinicamente mais relevante.

Conclusão

Deficiência de hormônio da tireoide durante a vida fetal pode enfraquecer funções cardíacas normais em ratos adultos, efeito pelo menos em parte devido ao aumento da expressão da relação de β- para α- MCP no coração.

REFERÊNCIAS

1 De Boo HA, Harding JE. The developmental origins of adult disease (Barker) hypothesis. Aust N Z J Obstet Gynaecol. 2006;46(1):4-14.
2 Fowden AL, Giussani DA, Forhead AJ. Intrauterine programming of physiological systems: causes and consequences. Physiology (Bethesda). 2006;21:29-37.
3 Bourguignon JP, Parent AS. Early homeostatic disturbances of human growth and maturation by endocrine disrupters. Curr Opin Pediatr. 2010;22(4):470-7.
4 Patel J, Landers K, Li H, Mortimer RH, Richard K. Thyroid hormones and fetal neurological development. J Endocrinol. 2011;209(1):1-8.
5 Thornburg KL. Foetal programming reveals the dark side of AT(2)R. Cardiovasc Res. 2011;89(2):260-1.
6 Ghanbari M, Jeddi S, Bagheripuor F, Ghasemi A. The effect of maternal hypothyroidism on cardiac function and tolerance to ischemia-reperfusion injury in offspring male and female rats. J Endocrinol Invest. 2015;38(6):915-22.
7 van Rooij E, Quiat D, Johnson BA, Sutherland LB, Qi X, Richardson JA, et al. A family of microRNAs encoded by myosin genes governs myosin expression and muscle performance. Dev Cell. 2009;17(5):662-73.
8 Oliveira-Carvalho V, Carvalho VO, Bocchi EA. The emerging role of miR-208a in the heart. DNA Cell Biol. 2013;32(1):8-12.
9 van Rooij E, Sutherland LB, Qi X, Richardson JA, Hill J, Olson EN. Control of stress-dependent cardiac growth and gene expression by a microRNA. Science. 2007;316(5824):575-9.
10 Gupta MP. Factors controlling cardiac myosin-isoform shift during hypertrophy and heart failure. J Mol Cell Cardiol. 2007;42(4):388-403.
11 Jeddi S, Zaman J, Ghasemi A. Effects of ischemic postconditioning on the hemodynamic parameters and heart nitric oxide levels of hypothyroid rats. Arq Bras Cardiol. 2015;104(2):136-43.
12 Yousefzadeh N, Alipour MR, Soufi FG. Deregulation of NF-small ka, CyrillicB-miR-146a negative feedback loop may be involved in the pathogenesis of diabetic neuropathy. J Physiol Biochem. 2015;71(1):51-8.
13 Vincent MA, Rodd C, Dussault JH, Van Vliet G. Very low birth weight newborns do not need repeat screening for congenital hypothyroidism. J Pediatr. 2002;140(3):311-4.
14 Newsome CA, Shiell AW, Fall CH, Phillips DI, Shier R, Law CM. Is birth weight related to later glucose and insulin metabolism?--A systematic review. Diabet Med. 2003;20(5):339-48.
15 Kuh D, Mishra GD, Black S, Lawlor DA, Davey Smith G, Okell L, et al. Offspring birth weight, gestational age and maternal characteristics in relation to glucose status at age 53 years: evidence from a national birth cohort. Diabet Med. 2008;25(5):530-5.
16 Forhead AJ, Fowden AL. Thyroid hormones in fetal growth and prepartum maturation. J Endocrinol. 2014;221(3):R87-R103.
17 Mourouzis I, Dimopoulos A, Saranteas T, Tsinarakis N, Livadarou E, Spanou D, et al. Ischemic preconditioning fails to confer additional protection against ischemia-reperfusion injury in the hypothyroid rat heart. Physiol Res. 2009;58(1):29-38.
18 Chizzonite RA, Zak R. Regulation of myosin isoenzyme composition in fetal and neonatal rat ventricle by endogenous thyroid hormones. J Biol Chem. 1984;259(20):12628-32.
19 Stelzer JE, Brickson SL, Locher MR, Moss RL. Role of myosin heavy chain composition in the stretch activation response of rat myocardium. J Physiol. 2007;579(Pt1):161-73.
20 Patel M, Mishra V, Pawar V, Ranvir R, Sundar R, Dabhi R. Evaluation of acute physiological and molecular alterations in surgically developed hypothyroid Wistar rats. J Pharmacol Pharmacother. 2013; 4(2):110-5.
21 Dillmann WH. Biochemical basis of thyroid hormone action in the heart. Am J Med. 1990;88(6):626-30.
22 Wibo M, Feron O, Zheng L, Maleki M, Kolar F, Godfraind T. Thyroid status and postnatal changes in subsarcolemmal distribution and isoform expression of rat cardiac dihydropyridine receptors. Cardiovasc Res.1998;37(1):151-9.
23 Meehan J, Kennedy JM. Influence of thyroid hormone on the tissue-specific expression of cytochrome c oxidase isoforms during cardiac development. Biochem J. 1997; 327 (Pt 1):!55-60.