Papéis contrastantes das variantes polimórficas dos genes TGFB1 e IFNG do doador e do receptor na rejeição crônica de transplantados renais

Papéis contrastantes das variantes polimórficas dos genes TGFB1 e IFNG do doador e do receptor na rejeição crônica de transplantados renais

Autores:

Verônica Porto Carreiro de Vasconcellos Coelho,
Rafael Ioschpe,
Cristina Caldas,
Monica Spadafora-Ferreira,
João Americo Fonseca,
Maria Regina Alves Cardoso,
Selma Aliotti Palacios,
Jorge Kalil,
Anna Carla Goldberg

ARTIGO ORIGINAL

Einstein (São Paulo)

versão impressa ISSN 1679-4508versão On-line ISSN 2317-6385

Einstein (São Paulo) vol.9 no.1 São Paulo jan./mar. 2011

http://dx.doi.org/10.1590/s1679-45082011ao1852

INTRODUÇÃO

Apesar do conhecimento acumulado, os motivos pelos quais alguns pacientes, mas não outros, com históricos clínicos similares, desenvolvem rejeição crônica após transplante renal ainda não são claros. A natureza inflamatória da rejeição tem levado à investigação sobre a contribuição de polimorfismos genéticos das citocinas nos desfechos de enxertos de órgãos sólidos, especialmente no caso dos rins. Os primeiros estudos, iniciados há mais de 10 anos em pacientes com transplante renal, evidenciaram uma associação entre o alelo −308 TNFA de alta produção e um genótipo IL10 de baixa produção com a rejeição aguda (1, 2) e do IFNG CA repeat polimórfico e genótipo IL10 na rejeição crônica (2).

A nefropatia crônica do aloenxerto (CAN) é identificada por um declínio progressivo de função renal, e se apresenta com características histológicas típicas. Estas incluem os marcos característicos de processos inflamatórios, tais como infiltração por células mononucleares, inflamação perivascular e intersticial, fibrose, hiperplasia da intima levando à diminuição parcial ou total da luz vascular, atrofia tubular, e mesmo glomeruloesclerose e isquemia. Após 10 anos, mais de 50% dos pacientes terão desenvolvido CAN (3) culminando com a perda do próprio enxerto. A despeito da crescente melhoria de protocolos de imunossupressão, CAN continua sendo um problema significante em parte como resultado do uso de inibidores de calcineurina. Além disso, uma variedade de fatores tem sido relatada em associação com o desenvolvimento e a progressão de CAN. A disparidade doador/receptor de HLA (antígeno leucocitário humano), base para a alorreatividade e rejeição aguda, é um importante fator de risco; idade do doador, tempo de isquemia fria do enxerto, número de episódios de rejeição aguda, hyperlipoproteinemia, hipertensão, e episódios de infecção por CMV também têm sido estabelecidos como fatores na progressão de disfunção crônica do aloenxerto (revisto com detalhes em (4, 5)).

Nas fases iniciais de CAN, a expressão aumentada de HLA e de citocinas inflamatórias como IL-1 (Interleucina 1), IFN-γ (Interferon gama), e TNF-α (Fator de necrose tumoral alfa), além de MCP-1 (proteína quimiotática monocitária 1) está presente, à medida que células mononucleares infiltram o rim e aderem ao endotélio. Numa fase posterior, concomitante à proliferação de miofibroblastos e hiperplasia da intima, as citocinas alternam para um perfil tipo 2 que inclui IL-4, IL-10, e TGF-β1 (fator de crescimento transformador beta 1), assim como PDGF (fator de crescimento derivado de plaquetas) e EGF (fator de crescimento epidérmico)(6). Esta combinação de fatores é responsável pela transformação fenotípica de fibroblastos em miofibroblastos (7). O endotélio e as células de músculo liso coram de forma brilhante para TNF-α, PDGF, e TGF-β1 (8). TGF-β1 também é expresso em fibroblastos e áreas de fibrose (9). Embora estudos de imunohistoquímica mostrem que o TGF-β1 esteja presente em biópsias de rins com rejeição aguda ou crônica, na rejeição crônica é observada uma coloração claramente realçada do interstício. (10). Finalmente, a ciclosporina A, a principal droga de imunossupressão usada em pacientes com transplante renal, tem mostrado induzir a produção de TGF-β1 em uma linhagem celular tubular proximal (11), e um efeito similar tem sido descrito para tacrolimo (12). Por outro lado, repetidas vezes o TGF-β1 tem sido relatado como uma citocina regulatória que desempenha um importante papel em muitos modelos de tolerância, contribuindo para a capacidade imunossupressiva de linfócitos T CD4+CD25+ circulantes in vivo (13).

OBJETIVOS

Neste estudo, investigamos os polimorfismos de alguns genes de citocinas envolvidos nos primeiros passos e no progresso da aterosclerose, além de citocinas que sabidamente são de fase efetora e reguladora, com o objetivo de identificar a susceptibilidade de genes para CAN (14). Os polimorfismos de genes de citocinas candidatas foram comparados entre grupos de pares doadores/receptores com ou sem CAN, pareados da melhor maneira possível quanto aos principais fatores de risco para CAN, como o nível de disparidades HLA, tipo e idade do doador, número de episódios de rejeição aguda, presença de hipertensão, e infecção por citomegalovírus (CMV).

MÉTODOS

Pacientes e o Seguimento [follow-up]

Este estudo retrospectivo caso-controle de comparação de dois grupos de pacientes, incluiu pacientes que foram submetidos a transplante renal e seus respectivos doadores no Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo. O Comitê de Ética aprovou este estudo e os pacientes concederam seu consentimento livre e informado para as coletas de sangue. As biópsias renais foram feitas segundo indicações clínicas, e foram classificadas de acordo com os critérios de Banff (15). Foram analisadas amostras de DNA de 102 pares doador/receptor de transplantes renais. A maioria dos pacientes recebeu seu transplante entre os anos 1995 e 2000. Destes, 56 receptores apresentaram CAN comprovada por biópsia, e 46 se mostraram livres de CAN com um seguimento mínimo de 39 meses. Os dois grupos foram comparados quanto a importantes fatores de risco, tais como compatibilidade HLA (com duas exceções, todos os pares doador:receptor foram haploidênticos ou não idênticos), nível de sensibilização anterior, número de transfusões, e número de episódios de rejeição aguda. Os grupos também foram pareados quanto a fatores de progressão, tais como tipo de doador (vivo parente ou não aparentado) e sua idade, presença de hipertensão, hipercolesterolemia, e presença de anticorpos IgG anti-CMV. A maioria dos pacientes foi tratada com terapia imunossupressora convencional tripla usando ciclosporina, azatioprina, e prednisona. Entretanto, 68% dos pacientes tiveram seus tratamentos mudados para receber MMF na ocasião do diagnóstico de CAN, e alguns dos pacientes transplantados mais recentemente receberam MMF desde o começo. As características demográficas são mostradas na Tabela 1.

Tabela 1 Dados demográficos e clínicos de pacientes com e sem nefropatia crônica do aloenxerto (CAN) 

Características Pacientes com CAN Pacientes sem CAN
Pares 56 46
Gênero M/F 26/30 24/22
Doadores vivosa 39 (69,6%)b 35 (76,0%)
Idade dos doadoresc 38,37 ± 12,05 34,38 ± 12,13
Histocompatibilidade - IDd 3 (5,4%) 0
Histocompatibilidade -HAd 25 (44,6%) 23 (50,0%)
Histocompatibilidade –NId 28 (50,0%) 23 (50,0%)
Meses de seguimento 118,9 ± 35,8 94,4 ± 31,0
Episódios de rejeição aguda (presentes) 33 (58,9%) 20 (43,5%)
CMV positivo pós-transplante 3 4
Hiperuricemia (presente)e 28 (50,0%) 20 (30,0%)
Perda do enxerto devido ao CAN 26 (46,4%)
Valores médios de creatinina (mg/dL) (última medida)f 4,27 {1,1-22,0} 1,84 {0,6 – 7,8}
Transfusões pré- transplante (n≥ 2) 24 (54,5%) 26 (61,9%)
Dislipidemia 33 (71,7%) 20 (54,1%)
Hipertensão 40 (81,6%) 31 (81,6%)
n por análise multivariada 44 42

aObs: 4 (com CAN) e 9 (sem CAN) doadores vivos não eram parentes (diferença não significativa)

bValores entre parênteses são porcentagens do número total de pacientes no grupo

cValores são medias ± desvio padrão (sem diferença significativa no teste t de Student para amostras não pareadas)

dID - HLA doador idêntico (irmãos; 0/6 incompatibilidades)

HA – doadores haploidênticos 1-3/6 incompatibilidades

NI – doadores não idênticos 4-6/6 incompatibilidades

eInformações não disponíveis em 16 pacientes com CAN e em 6 sem CAN

fValores entre chaves correspondem a amplitude dos valores encontrados no grupo

Extração e genotipagem de DNA

As amostras de sangue foram colhidas e o DNA foi extraído por DTAB/CTAB (brometo de dodeciltrimetilamonio/brometo de cetiltrimetilamonio)(16) ou, por métodos de salting-out conforme descrição anterior (17). A não ser quando especificado, a genotipagem de citocinas de 24 SNPs (polimorfismos de nucleotídeos únicos) em 18 genes foi realizada por PCR-SSP (reação de cadeia de polimerase com primers sequência-específicos) em placas preparadas projetadas para o 13th International Histocompatibility Workshop on Cytokine Polymorphism pelo centro Collaborative Transplant Study em Heidelberg (http://www.ctstransplant.org/public/reagents.shtml). Em suma, a tipagem por PCR-SSP feito com o kit de Heidelberg consistiu de 48 misturas de primers PCR dispensadas em placas de PCR com 96 cubas. O mix Master (tampão de MgCl2, dNTPs, e glicerol) foi combinado com 20 U Taq polimerase e 1,2 – 3,0 µg DNA, e dispensado nas placas. Os produtos passaram por eletroforese em agarose gel 2% e foram interpretados conforme definição pelo protocolo do Workshop. O kit de Heidelberg permitiu a haplotipagem por SNP para os genes IL1B (-511 C/T e +3692 C/T), TGFB1 (códon 10 C/T e 25 G/C), TNFA (-238 G/A, e −308 G/A), IL2 (-330 T/G e +160 G/T), IL4 (-1098 T/G, −590 C/T e −33 C/T), IL6 (-174 G/C, nt565 G/A), IL10 (-1082 G/A,-819 T/C e −590 A/C), e ICAM1 (G6241R e E465D). A placa também permitiu a tipagem para SNPs isolados em genes codificados para IFNG (3´UTR5644 A/T), IL1A (-889 C/T), IL1R (pst1970 C/T), IL1RN (mspa111100 C/T), IL12B (-1188 A/C), e IL4RA (+1902 G/A). MCP1 SNP na posição −2518 (A/G) foi analisada por PCR-RFLP, usando os seguintes primers: forward CCGAGATGTTCCCAGCACAG e reverse CTGCTTTGCTTGTGCCTCTT (18).

Análise estatística

Foram realizadas analises bivariáveis, tomando CAN como a variável dependente e os diferentes polimorfismos genéticos investigados como variáveis independentes. As variáveis que foram significantes nas análises bivariáveis foram as primeiras inseridas nos modelos de regressão logística múltipla, mas todas as outras variáveis foram testadas. Dois critérios foram usados para manter as variáveis no modelo final: significância estatística (p<0,05) ou uma clara alteração nas estimativas dos efeitos de alguns polimorfismos produzidos por aquelas não selecionadas no primeiro passo da análise (19). As analises foram realizadas usando software STATA, versão 8.0.

RESULTADOS

Analisamos 17 diferentes polimorfismos de genes; a maioria, citocinas associadas à inflamação e/ou aterosclerose, em amostras tanto de DNA doador e de receptor. Não houve desvio das proporções Hardy-Weinberg esperadas em qualquer dos genes analisados. A maioria dos SNPs analisada, incluindo aqueles de IL1B (2 SNPs), IL4 (3 SNPs), IL10 (3 SNPs), ICAM1 (2 SNPs), e MCP1, foram igualmente distribuídos em grupos com e sem CAN, em amostras de doadores e de receptores. As análises preliminares nos levaram a descartar TNFA, IL2, IL6, e IL12B como sendo não informativos na nossa população em função de sua frequência muito baixa na população hígida, e não foram testadas posteriormente. A Tabela 2 apresenta um resumo das frequências de alelos e haplótipos em todos os grupos.

Tabela 2 Resumo da frequência de alelos e haplótipos no grupos com e sem nefropatia crônica do aloenxerto (CAN) 

Frequência de Alelo/Haplótipo (%)1
Receptor Doador
Gene
Posição do SNP Alelo Sem CAN CAN Sem CAN CAN
IL1A C 71,1 69,8 69,6 67,9
-889 T 28,9 30,2 30,4 32,1
IL1B C 57,7 63,0 59,8 64,8
-511 T 42,3 37,0 40,2 35,2
IL1B C 80,0 80,5 84,8 83,0
3962 T 20,0 19,5 15,2 17,0
IL1R C 63,3 57,4 58,7 57,5
PstI 1970 T 36,7 42,6 41,3 42,5
IL1RA C 35,5 37,7 30,4 33,6
Mspa1 11100 T 64,5 62,3 69,6 66,4
IFNG A 58,9 59,8 60,0 63,2
UTR 5644 T 41,1 40,2 40,0 36,8
IL4* TTT 36,0 32,1 39,1 29,8
-1098/ – 590/ – 33 TCC 51,2 58,0 52,2 55,8
GTT 1,2 1,2 1,1 4,8
GCC 11,6 4,9 7,6 7,7
TTC 0,0 3,8 0,0 1,9
IL10 ACC 30,2 36,7 34,8 39,6
-1082/ –819/ −590 ATA 37,7 27,7 33,7 26,4
GCC 32,1 35,6 31,5 34,0
MCP1 A 73,0 72,0 67,4 73,6
-2518 G 27,0 28,0 32,6 26,4
ICAM1 GG 45,0 37,5 31,7 37,5
G6241R/E465D GA 48,3 53,6 56,7 53,6
AG 5,0 8,9 11,6 8,9
AA 1,7 0,0 0,0 0,0
TGFB1** T 56,7 52,8 44,6 57,6
cdn10 C 43,3 47,2 55,4 42,5
TGFB1 G 96,6 92,5 93,5 91,5
cdn25 C 3,4 7,5 6,5 8,5
TGFB1 CG 38,9 39,6 48,9 34,0
cdn10/cdn25 TG 56,7 52,9 44,6 57,5
CC 4,4 7,5 6,5 8,5

1De acordo com a literatura, os alelos associados com alto produção são: IL1A (-889*T), IL1B (-511*T; +3962*T), IL1RA (C), IFNG (T), TGFB1 (códon 10*T; códon 25*G), IL4 (-590*T; −33*T), IL10 (-1082*G, –819*C, −590*C), MCP1 (-2518*G)

UTR = região não traduzída; Pst1 e Mspa1 = enzimas de restrição; cdn = códon

*IL4, IL10, ICAM1 os dados são mostrados em forma de haplótipos

**TGFB1 os dados são mostrados como frequência de alelos e haplótipos. Genótipo TT (cdn 10) χ2 = 6,547, p = 0,0379

No caso de IL1A e IL1B, que são genes próximos, distantes apenas cerca de 60 kb, a tipagem dos alelos IL1A na posição –889, e de IL1B SNPs na posição −511 e +3962, revelou pelo menos 6 diferentes haplótipos. Entretanto, em quase metade dos casos, os haplótipos IL1A/IL1B não podiam ser claramente definidos. Em outras palavras, a comparação da distribuída do haplótipo IL1A/IL1B nos dois grupos não foi possível.

De todos os genes analisados, a única diferença significante revelada mediante análise do qui-quadrado foi a presença do genótipo TT de alta produção no códon 10 do gene TGFB12 = 6,547, p = 0,0379), presente em quase 40% dos receptores de transplantes portadores de CAN, comparados aos 15% no grupo livre de CAN.

Na análise multivariada, o alelo de baixa produção, IL1A, se mostrou discretamente protetor quando presente no enxerto (p=0,052). Os resultados da análise multivariada podem ser vistas na Tabela 3. Mais importante, o genótipo TT TGFB1 TT de alta produção (códon 10) foi protetor em receptores (p=0,017), mas conferiu um risco aumentado quando presente em amostras de doadores (p=0,049). Por outro lado, no caso de polimorfismo IFNG, o alelo de alta produção foi protetor na análise do doador (p=0,013), mas aumentou o risco de CAN quando estava presente em receptores (p=0,036). Finalmente, apesar do cuidado em fazer correspondência dos grupos com e sem CAN, e de acordo com a literatura publicada, a rejeição aguda foi confirmada como fator de risco para CAN (p=0,024). A hiperuricemia foi analisada em uma amostra menor (67 pares em vez de 86) e também mostrou ser um fator de risco para CAN (p=0,013, IC: 1,628-63,437, dados não mostrados). Em contrapartida, o tipo de doador, a idade do doador, o número de disparidades de HLA, a presença de hipertensão, dislipidemia, o número de transfusões pré-transplante, e os meses de seguimento, que também foram incluídos na análise multivariada, foram igualmente distribuídos, e, portanto, não tiveram impacto sobre o resultado da análise.

Tabela 3 Análise multivariada de polimorfismos de genes significativamente associados com CAN 

Rejeição crônica (CAN) OR ORadj 95%CIadj valor p
Rejeição celular aguda 1,87 4,12 1,20 – 14,13 0,024
TGFB códon 10 genótipo TT receptor 0,72 0,07 0,007 – 0,61 0,017
TGFB códon 10 genótipo TT doador 2,71 7,21 1,01 – 51,29 0,049
IFNG UTR5644 genótipo TT receptor 1,16 5,83 1,12 – 30,19 0,036
IFNG UTR5644 genótipo TT doador 0,72 0,16 0,04 – 0,68 0,013

ORadj = Ajustado para pareamento de HLA, MCP1 na posição –1025 genótipo receptor, MCP-1 na posição –1025 genótipo doador, IL1B SNP na posição −511 (alelo T) genótipo receptor, IL1B SNP na posição −511 (alelo C) genótipo doador, IL1R (pstl 1970) genótipo receptor, IL1R (pstl 1970) genótipo doador, IL1B na posição +3962 (C allele) genótipo receptor e outros genótipos na tabela.

DISCUSSÃO

Nossa análise caso:controle de polimorfismos genéticos individuais revelou um aumento significante do genótipo de alta produção TGFB1 em doadores do grupo portador de CAN. Houve uma tendência para significância em vários outros polimorfismos de genes de citocinas analisadas, todavia o número relativamente baixo de pacientes neste estudo tem um impacto sobre esse tipo de análise. Assim, para poder contrabalançar o menor poder da análise individual, usamos a análise multivariada em que todas as variáveis foram consideradas. Esta análise mostrou resultados claros, confirmando fatores de risco conhecidos como episódios de rejeição aguda, além de discriminar polimorfismos genéticos de citocinas de conferem proteção e risco. Este foi o caso de TGFB1 e IFNG. Foi confirmado em uma análise multivariada que o genótipo de alta produção TGFB1 TT (códon 10) do doador tem associação com CAN, mas o mesmo genótipo, quando presente nos receptores, conferiu proteção. De fato, apesar do efeito de TGF-β1 de reparação de túbulo de curto prazo do enxerto, sua dominante produção aumentada intra-enxerto parece ter um efeito geral negativo, aumentando a progressão da rejeição crônica, e realçando a proliferação de miofibroblastos e de fibrose. Há um reconhecimento crescente da importância do aumento de TGF-β1 não apenas quando CAN já está presente, mas também durante episódios de rejeição aguda e a ocorrência de nefrotoxicidade da ciclosporina, situações claramente associadas com o desenvolvimento de CAN (2022). Um aumento da transcrição pós-transplante de TGFB1 no enxerto do doador como resultado de polimorfismo genético poderia explicar, em parte, estas observações. Este desfecho contrasta com a produção de TGF-β1 pelos linfócitos T do receptor, onde está ligado à supressão e down-regulation de respostas inflamatórias, como é amplamente relatado na literatura (23). Consequentemente, Park e cols. (24) encontraram que a frequência de genótipos TGFB1 de produção mais baixa e intermediaria (códon 10 CC e códon 25 GG) era significantemente maior em pacientes com episódios agudos recorrentes, enquanto os genótipos de alta produção estavam aumentados em doadores de pacientes com disfunção renal crônica do aloenxerto. É interessante destacar que este mesmo alelo de alta produção, TGFB1 códon 10 T, quando presente em homozigose em receptores de transplante renal, foi relatado como sendo potencial risco para o declínio de função do aloenxerto (25). Estes dados heterogêneos podem, pelo menos em parte, refletir o efeito de outros fatores relevantes de CAN, incluindo o efeito positivo ou negativo de outros polimorfismos genéticos.

A presença do genótipo TT associada a uma alta produção de IFN-γ na amostra do grupo de receptores foi identificada como fator de risco em receptores, enquanto sua presença em enxertos de doadores conferia proteção. Não temos, no momento, uma boa explicação para esta última observação. IFN-γ é produzido quase exclusivamente por NKT, NK, e linfócitos T ativados, e portanto a única fonte de IFN-γ no doador seria os linfócitos ainda presentes dentro dos enxertos nos primeiros momentos após o transplante. Em sustentação de um papel protetor de IFN-γ, uma possível explicação tem sido apresentada por Halloran e cols. (26) em um estudo com camundongos IFN-γ knock-out receptores onde foi demonstrado que IFN-γ era essencial para proteger aloenxertos localmente da necrose maciça que ocorria com o enxerto.

Possivelmente em função da redundância funcional das respostas imunes, repetidas vezes os polimorfismos de genes das citocinas têm mostrado ter um impacto modesto sobre a susceptibilidade geral a doença, a rejeição aguda, e ao desenvolvimento de CAN, a despeito de seus papéis significantes nas condições autoimunes e inflamatórias. Os riscos conferidos por alelos variantes de citocinas raramente alcançam valores de 2,5. O baixo impacto dessas variantes polimórficas, além de suas baixas frequências, poderão resultar em um desenho de estudo sem poder suficiente para identificar alvos relevantes com confiança. O número relativamente pequeno de pares de doadores/receptores, além do baixo risco genético conferido pelos polimorfismos das citocinas que estudamos, requerem que estes resultados sejam confirmados. Quando se investiga susceptibilidade multifatorial, o pareamento de grupos nas variáveis conhecidas ajuda a salientar diferenças ocultas. Assim, nossos grupos de estudo foram pareados quanto a tipo e idade do doador, compatibilidade HLA, presença de hipertensão, dislipidemia, número de transfusões pré-transplante, positividade CMV, e regime imunossupressor. Não foi surpreendente, então, que não pudemos controlar dois fatores de risco bem conhecidos, a saber, o número de episódios de rejeição aguda e hiperuricemia (27) que estavam significantemente aumentados no grupo com CAN.

Todavia, os dados que obtivemos estão, em geral, de acordo com a literatura publicada sobre o assunto (2830).

CONCLUSÃO

Nossos resultados enfatizam a importância de genotipagem de citocinas do doador e mostram que polimorfismos das citocinas presentes no tecido enxertado podem, de fato, contribuir para o desenvolvimento de CAN. A combinação de genotipagem do receptor e do doador poderá ajudar a escolher abordagens terapêuticas adicionais ou alternativas para pacientes transplantados renais com risco maior, tais como a introdução precoce de MMF ou outras drogas com potencial efeito de restrição sobre o desenvolvimento de CAN.

REFERÊNCIAS

1. Sankaran D, Asderakis A, Ashraf S, Roberts IS, Short CD, Dyer PA, et al. Cytokine gene polymorphisms predict acute graft rejection following renal transplantation. Kidney Int. 1999;56(1):281-8.
2. Asderakis A, Sankaran D, Dyer P, Johnson RW, Pravica V, Sinnott PJ, et al. Association of polymorphisms in the human interferon-gamma and interleukin-10 gene with acute and chronic kidney transplant outcome: the cytokine effect on transplantation. Transplantation 2001;71(5):674-7.
3. Nankivell BJ, Borrows RJ, Fung CL, O’Connell PJ, Allen RD, Chapman JR. The natural history of chronic allograft nephropathy. N Engl J Med. 2003;349(24):2326-33.
4. Joosten SA, Sijpkens YW, van Kooten C, Paul LC. Chronic renal allograft rejection: pathophysiologic considerations. Kidney Int. 2005;68(1):1-13.
5. Li C, Yang CW. The pathogenesis and treatment of chronic allograft nephropathy. Nat Rev Nephrol. 2009;5(9):513-9.
6. Shirwan H. Chronic allograft rejection. Do the Th2 cells preferentially induced by indirect alloantigen recognition play a dominant role? Transplantation. 1999;68(6):715-26.
7. Desmouliere A, Geinoz A, Gabbiani F, Gabbiani G. Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol.1993;122(1):103-11.
8. Noronha IL, Daniel V, Rambausek M, Waldherr R, Opelz G. Soluble interleukin-2 receptor (sIL-2R) and tumor necrosis factor plasma levels in renal allograft recipients. Transplant Proc. 1990;22(4):1859-60.
9. Cuhaci B, Kumar MS, Bloom RD, Pratt B, Haussman G, Laskow DA, et al. Transforming growth factor-beta levels in human allograft chronic fibrosis correlate with rate of decline in renal function. Transplantation. 1999;68(6):785-90.
10. Shihab FS, Yamamoto T, Nast CC, Cohen AH, Noble NA, Gold LI, et al. Transforming growth factor-beta and matrix protein expression in acute and chronic rejection of human renal allografts. J Am Soc Nephrol. 1995;6(2): 286-94.
11. Wolf G, Zahner G, Ziyadeh FN, Stahl RA. Cyclosporin A induces transcription of transforming growth factor beta in a cultured murine proximal tubular cell line. Exp Nephrol. 1996;4(5):304-8.
12. Shihab FS, Bennett WM, Tanner AM, Andoh TF. Mechanism of fibrosis in experimental tacrolimus nephrotoxicity. Transplantation. 1997;64(12):1829-37.
13. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, et al. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med. 2003;198(12):1875-86.
14. Smith AJ, Humphries SE. Cytokine and cytokine receptor gene polymorphisms and their functionality. Cytokine Growth Factor Rev. 2009;20(1):43-59.
15. Racusen LC, Solez K, Colvin RB, Bonsib SM, Castro MC, Cavallo T, et al. The Banff 97 working classification of renal allograft pathology. Kidney Int. 1999;55(2):713-23.
16. Gustincich S, Manfioletti G, Del Sal G, Schneider C, Carninci P. A fast method for high-quality genomic DNA extraction from whole human blood. Biotechniques 1991;11(3):298-300- 2.
17. Bignon JD, Viña MF. HLA class II typing by PCR-SSOP. Charron D, Fauchet R, editors. Paris: EDK Medical and Scientific International Publisher; 1995.
18. Rovin BH, Lu L, Saxena R. A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression. Biochem Biophys Res Commun. 1999;259(2):344-8.
19. Clayton D, Hills M. New York: Oxford University Press; 1996.
20. Sharma VK, Ding R, Li B, Bologa RM, Lagman M, Eduafo A, et al. Molecular correlates of human renal allograft rejection. Transplant Proc. 1998;30(5):2364-6.
21. Pribylova-Hribova P, Kotsch K, Lodererova A, Viklicky O, Vitko S, Volk HD, et al. TGF-beta1 mRNA upregulation influences chronic renal allograft dysfunction. Kidney Int. 2006;69(10):1872-9.
22. Palomar R, Mayorga M, Ruiz JC, Cuevas J, Rodrigo E, Cotorruelo JG, et al. Markers of fibrosis in early biopsies of renal transplants. Transplant Proc. 2005;37(3):1468-70.
23. Huber S, Schramm C, Lehr HA, Mann A, Schmitt S, Becker C, et al. Cutting edge: TGF-beta signaling is required for the in vivo expansion and immunosuppressive capacity of regulatory CD4+CD25+ T cells. J Immunol. 2004;173(11):6526-31.
24. Park JY, Park MH, Park H, Ha J, Kim SJ, Ahn C. TNF-alpha and TGF-beta1 gene polymorphisms and renal allograft rejection in Koreans. Tissue Antigens. 2004; 64(6):660-6.
25. Chow KM, Szeto CC, Poon P, Lau WY, Lai FM, Li PK. Transforming growth factor-beta1 gene polymorphism in renal transplant recipients. Ren Fail. 2005;27(6):671-5.
26. Halloran PF, Miller LW, Urmson J, Ramassar V, Zhu LF, Kneteman NM, et al. IFN-gamma alters the pathology of graft rejection: protection from early necrosis. J Immunol. 2001;166(12):7072-81.
27. Perico N, Codreanu I, Caruso M, Remuzzi G. Hyperuricemia in kidney transplantation. Contrib Nephrol. 2005;147:124-31.
28. Hoffmann S, Park J, Jacobson LM, Muehrer RJ, Lorentzen D, Kleiner D, et al. Donor genomics influence graft events: the effect of donor polymorphisms on acute rejection and chronic allograft nephropathy. Kidney Int. 2004;66(4): 1686-93.
29. Hutchinson IV. The role of transforming growth factor-beta in transplant rejection. Transplant Proc. 1999;31(7A):9S-13S.
30. Awad MR, El-Gamel A, Hasleton P, Turner DM, Sinnott PJ, Hutchinson IV. Genotypic variation in the transforming growth factor-beta 1 gene: association with transforming growth factor-beta 1 production, fibrotic lung disease, and graft fibrosis after lung transplantation. Transplantation. 1998;66(8):1014-20.
Política de Privacidade. © Copyright, Todos os direitos reservados.