Polimorfismo da Enzima Conversora da Angiotensina (ECA D/I) em Pacientes com Insuficiência Cardíaca de Etiologia Chagásica

Polimorfismo da Enzima Conversora da Angiotensina (ECA D/I) em Pacientes com Insuficiência Cardíaca de Etiologia Chagásica

Autores:

Silene Jacinto da Silva,
Salvador Rassi,
Alexandre da Costa Pereira

ARTIGO ORIGINAL

Arquivos Brasileiros de Cardiologia

versão impressa ISSN 0066-782Xversão On-line ISSN 1678-4170

Arq. Bras. Cardiol. vol.109 no.4 São Paulo out. 2017 Epub 28-Set-2017

https://doi.org/10.5935/abc.20170137

Resumo

Fundamento:

Alterações no gene da Enzima Conversora de Angiotensina (ECA) podem contribuir para o aumento da pressão arterial e consequentemente para o surgimento de insuficiência cardíaca (IC). O papel do polimorfismo ainda é bastante controverso, sendo necessária sua identificação em pacientes com IC de etiologia chagásica na população brasileira.

Objetivo:

Determinar o polimorfismo da ECA em portadores de IC com etiologia chagásica e pacientes com doença de Chagas sem disfunção sistólica, e avaliar a relação do polimorfismo ECA com diferentes variáveis clínicas.

Métodos:

Trata-se um estudo clínico comparativo com 193 participantes, destes, 103 com IC de etiologia chagásica e 90 pacientes com doença de Chagas sem disfunção sistólica, todos em atendimento ambulatorial no Hospital das Clínicas da Universidade Federal de Goiás. Os alelos D e I do polimorfismo da ECA foram identificados por reação em cadeia da polimerase dos respectivos fragmentos provenientes do íntron 16 no gene da ECA e visualizados em eletroforese.

Resultados:

Dos portadores de IC, 63 % eram do gênero masculino, enquanto nos portadores de doença de Chagas sem disfunção sistólica 53,6% eram do gênero feminino (p = 0,001). O tempo de diagnóstico variou de 1 a 50 anos. A distribuição dos genótipos DD, DI e II foi semelhante entre os dois grupos, não apresentando significância estatística (p = 0,692). Nenhuma interação foi observada em relação às características clínicas e os genótipos D/I entre os grupos. A idade foi significativamente diferente entre os grupos (p = 0,001), e a média de idade dos pacientes com IC foi de 62,5 anos.

Conclusão:

Não foram observadas diferenças na distribuição das frequências dos genótipos (Deleção/Inserção) do polimorfismo ECA entre os grupos estudados. A utilização deste biomarcador genético não se mostrou útil na tentativa de se conhecer a existência da relação do polimorfismo ECA e as manifestações clínicas da IC de etiologia chagásica.

Palavras-chave: Doença de Chagas; Polimorfismo Genético; Insuficiência Cardíaca; Cardiomiopatia Chagásica

Abstract

Background:

Changes in the angiotensin-converting enzyme (ACE) gene may contribute to the increase in blood pressure and consequently to the onset of heart failure (HF). The role of polymorphism is very controversial, and its identification in patients with HF secondary to Chagas disease in the Brazilian population is required.

Objective:

To determine ACE polymorphism in patients with HF secondary to Chagas disease and patients with Chagas disease without systolic dysfunction, and to evaluate the relationship of the ACE polymorphism with different clinical variables.

Methods:

This was a comparative clinical study with 193 participants, 103 of them with HF secondary to Chagas disease and 90 with Chagas disease without systolic dysfunction. All patients attended the outpatient department of the General Hospital of the Federal University of Goias general hospital. Alleles I and D of ACE polymorphism were identified by polymerase chain reaction of the respective intron 16 fragments in the ACE gene and visualized by electrophoresis.

Results:

In the group of HF patients, 63% were male, whereas 53.6% of patients with Chagas disease without systolic dysfunction were female (p = 0,001). The time from diagnosis varied from 1 to 50 years. Distribution of DD, ID and II genotypes was similar between the two groups, without statistical significance (p = 0,692). There was no difference in clinical characteristics or I/D genotypes between the groups. Age was significantly different between the groups (p = 0,001), and mean age of patients with HF was 62.5 years.

Conclusion:

No differences were observed in the distribution of (Insertion/Deletion) genotype frequencies of ACE polymorphism between the studied groups. The use of this genetic biomarker was not useful in detecting a possible relationship between ACE polymorphism and clinical manifestations in HF secondary to Chagas disease.

Keywords: Chagas Disease; Polymorphism, Genetic; Heart Failure; Chagas Cardiomyopathy

Introdução

A doença de Chagas apresenta características endêmicas e constitui importante causa de cardiomiopatia dilatada e insuficiência cardíaca (IC) em regiões de baixas condições socioeconômicas, acarretando elevados índices de morbimortalidade. O diagnóstico e tratamento precoce são medidas importantes para a melhora da sobrevida e da qualidade de vida.1

Na região centro-oeste, estudos2-4 mostraram que a doença de Chagas foi considerada a principal causa de IC. É a primeira causa de IC em áreas endêmicas, e a terceira causa no Brasil. A morte súbita cardíaca acomete aproximadamente 50% dos pacientes com IC secundária à doença de Chagas.5

A maioria dos problemas de saúde humana, incluindo a IC tem etiologia multifatorial, influenciada pelo meio ambiente, estilo de vida, e fatores genéticos. Os distúrbios multifatoriais são caracterizados por contribuições fenotípicas de vários genes que interagem uns com os outros e com os fatores ambientais. Muitos distúrbios que são manifestados no indivíduo adulto são caracterizados por herança autossômica dominante, incluindo as formas hereditárias de cardiomiopatia.6

O gene da enzima conversora da angiotensina (ECA) (21 kb) está localizado no cromossomo 17, braço longo (q), região 23 e se caracteriza por apresentar 24 íntrons.7 Predizer a resposta individual ao tratamento e os riscos potenciais de efeitos adversos aos medicamentos é uma aspiração para o tratamento da IC. Com o crescimento da biologia molecular e das informações genéticas, gradualmente há a necessidade de uma redefinição das doenças baseada nos processos bioquímicos que as compõe e não no fenótipo com que elas apresentam. O conhecimento e tratamento das doenças cardíacas, o isolamento e a caracterização dos genes envolvidos poderão não constituir uma panaceia, mas sim um ponto de partida para o tratamento individualizado.

Neste contexto, o presente estudo teve como objetivo verificar a distribuição do polimorfismo ECA (D/I) em portadores de IC de etiologia chagásica, comparar essa distribuição com a de portadores da doença de Chagas sem disfunção sistólica, e avaliar sua relação com algumas variáveis clínicas.

Aspectos Éticos

O estudo foi analisado e aprovado pelo Comitê de Ética em Pesquisa do Hospital das Clínicas da Universidade Federal de Goiás, número do parecer: 908.870 em 16 de Dezembro de 2014.

Delineamento do estudo

Trata-se de um estudo clínico comparativo realizado em dois grupos de pacientes (grupo A e grupo B) provenientes dos Ambulatórios de Cardiologia e Ambulatório de Chagas do Hospital das Clínicas (HC/UFG). O período de admissão dos pacientes no estudo foi de fevereiro de 2014 a outubro de 2015.

Pacientes

Foram selecionados de forma consecutiva 193 pacientes. Sendo 103 pertencentes ao grupo A (portadores de IC de etiologia chagásica) e 90 pertencentes ao grupo B (portadores de doença de Chagas sem disfunção sistólica). Todos pacientes encontravam-se em acompanhamento ambulatorial.

Critérios de inclusão

Grupo A: Pacientes com IC sintomática (pelos critérios de Framingham) de etiologia chagásica. Grupo B: Pacientes com diagnóstico de doença de Chagas sem disfunção sistólica.

Critérios de exclusão

Disfunção cardíaca no grupo B que levou à exclusão dos indivíduos deste estudo.

Parâmetros clínicos e laboratoriais

Todos os dados clínicos foram extraídos do prontuário médico. Para expressar o status clínico atual do paciente, foram considerados exames laboratoriais, e resultados de eletrocardiograma e ecodopplercardiograma mais recentes disponíveis.

Nos pacientes com IC, a classe funcional foi determinada de acordo com a New York Heart Association, de acordo com a equipe médica ambulatorial. Para os exames de ecodopplercardiograma foram analisados os seguintes parâmetros: Átrio Esquerdo (AE), Diâmetro Sistólico de Ventrículo Esquerdo (DSVE), Diâmetro Diastólico de Ventrículo Esquerdo (DDVE) e Fração de Ejeção de Ventrículo Esquerdo (FEVE).

Genotipagem

Foram coletados amostras de 8 mL de sangue e armazenados em dois tubos contendo EDTA como anticoagulante. Posteriormente, foi realizada a extração de DNA, seguido da genotipagem para o polimorfismo ECA pela Reação em Cadeia da Polimerase (PCR), classificada em D/D (Deleção/Deleção), D/I (Deleção/Inserção) ou I/I (Inserção/Inserção).

O método de genotipagem foi adaptado de Lindpaintner et al.,8 para um volume final de 25 µL foram adicionados 1 mM de primers, 200 mM de desoxinucleotídeos trifosfatados (dATP, dCTP, dGTP, dTTP), 1,3 mM de cloreto de magnésio, 50 mM de cloreto de potássio, 0,5 unidade de Taq DNA polimerase e 20 ng de DNA. Os primers sense GCCCTGCAGGTGTCTGCAGCATGT e antisense GGATGGCTCTCCCCGCCTTGTCTC foram usados para amplificar os alelos D e I, resultando em amplicons de 319pb e 597pb respectivamente. O protocolo de amplificação do DNA constituiu-se por uma desnaturação inicial de 94°C por 5 minutos, seguido de 35 ciclos, sendo 30 segundos a 94°C, 45 segundos a 56°C, 2 minutos a 72°C, e 7 minutos a 72°C. O produto da amplificação dos alelos D e I foram submetidos à eletroforese em gel de agarose 1,5% e corados com brometo de etídio a 0,5 mg/mL por 10 minutos. Devido a amplificação preferencial do alelo D em heterozigose, as amostras com o genótipo DD foram reamplificadas com primers TGGGACCACAGCCGCGCCTACCAC e TCGGCCCTCCCACCACCATGCTAA sense e antisense respectivamente, em idênticas condições de PCR, com exceção da temperatura de anelamento à 67°C. A avaliação dos produtos de PCR em gel de agarose a 1,5% revelaram um amplicon de 335 pb na presença de um alelo I. Os resultados foram capturados pelo sistema de vídeo-documentação Image Master VDS® (Pharmacia Biotech, EUA).

Análise estatística

A estatística descritiva foi utilizada para caracterização das variáveis - as variáveis categóricas foram descritas em percentuais, as variáveis contínuas com distribuição normal em médias ± desvios-padrão, e as variáveis contínuas de distribuição não normal em mediana e intervalos interquartis. O teste de Kolmogorov-Smirnov Z foi utilizado para identificar as variáveis contínuas com distribuição normal. Diferenças entre os grupos A e B foram calculadas utilizando o teste de qui-quadrado ou teste t de Student não pareado e, quando apropriado, o teste de Man-Whitney. A medida de associação entre as variáveis de exposição à IC foi o Odds Ratio (OR), com respectivos intervalos de 95% de confiança. Variáveis foram consideradas estatisticamente diferentes entre os grupos quando os valores de p foram menores que 0,05. Os resultados foram analisados por meio do programa estatístico SPSS, versão 18.0.

Resultados

Foi observada diferença significativa na distribuição de gêneros entre os grupos (p = 0,023), com 63% dos pacientes com IC do gênero masculino.

A média de idade dos pacientes com IC foi de 62,5 ± 11,1 anos, apresentando diferença significativa entre os grupos (p = 0,00). As características sociodemográficas e clínicas da amostra encontram-se na Tabela 1.

Tabela 1 Características sociodemográficas e clínicas da amostra 

Variáveis Grupo A Grupo B OR IC95% Valor de p
n % n %
Gênero
Masculino 51 63,0 30 37,0 1,96 1,09-3,52 0,023a
Feminino 52 46,4 60 53,6
Média de idade (DP) 62,5 (11,1) 51,3 (11,9) 0,000b
Procedência
Goiânia 59 54,6 49 45,4 1,12 0,64-1,98 0,692a
Outras localidades 44 51,8 41 48,2
Mediana do tempo de diagnóstico da doença de Chagas (intervalo inter-quartil) 15 (8-25) 9,5 (5-17) 0,002c
Tabagismo
Sim 30 73,2 11 26,8 2,95 1,38-6,32 0,004a
Não 73 48,0 79 52,0
Etilismo
Sim 21 42,0 29 58,0 0,34 0,28-1,03 0,061a
Não 82 57,3 61 42,7
Mediana da FC (bpm)(intervalo inter-quartil) 65 (60-80) 65 (60-80) 0,290c
Megaesôfago
Sim 18 38,3 29 61,7 0,45 0,23-0,87 0,017a
Não 85 58,2 61 41,8
Megacólon
Sim 9 64,3 5 35,7 1,63 0,53-5,05 0,395a
Não 94 52,5 85 47,5
Dislipidemia
Sim 15 75,0 5 25,0 2,90 1,01-8,32 0,041a
Não 88 50,9 85 49,1
Diabetes mellitus
Sim 6 54,5 5 45,5 1,05 0,31-3,57 0,936a
Não 97 53,3 85 46,7

DP: desvio padrão; FC: frequência cardíaca; Grupo A: pacientes com insuficiência cardíaca de etiologia chagásica; Grupo B: pacientes com doença de Chagas sem disfunção sistólica; bpm: batimentos por minuto; OR: odds ratio.

ateste do qui-quadrado;

bteste t de Student não pareado;

cTeste de Mann Whitney.

Todos os pacientes com IC estavam em tratamento medicamentoso, 73,2% era tabagista, esse hábito foi estatisticamente significativo entre os grupos (p = 0,004). Em relação às comorbidades associadas à IC, houve predomínio de dislipidemia (75%). A média da frequência cardíaca foi maior nos pacientes com IC (p = 0,030) em comparação ao grupo B.

A presença de megaesôfago foi prevalente apenas no grupo B (61,7%), com diferença estatisticamente significativa entre os grupos (p = 0,017). O tempo decorrido desde o diagnóstico da doença de Chagas foi estatisticamente diferente entre os grupos (p = 0,001).

Perfil genético da população estudada

A fim de estabelecer a prevalência dos genótipos para o polimorfismo ECA entre os pacientes do grupo A e grupo B, foram analisados a frequência dos genótipos DD, DI e II (Tabela 2). Não houve diferença estatisticamente significativa nas frequências observadas dos genótipos em relação às esperadas entre os grupos (p = 0,692).

Tabela 2 Polimorfismo D/I nos grupos A e B 

Genótipo Grupo A Grupo B Valor de p
N % N %
DD 17 50,0 17 50,0 0,692a
DI 59 56,2 46 43,8
II 27 50,0 27 50,0

DD: deleção/deleção; DI: deleção/inserção; II: inserção/inserção; grupo A: pacientes com insuficiência cardíaca de etiologia chagásica; Grupo B: pacientes com doença de Chagas sem disfunção sistólica.

ateste do qui-quadrado;

As médias dos valores das variáveis ecocardiográficas e os genótipos não foram estatisticamente diferentes entre os grupos. Os portadores do genótipo DI apresentaram média mais elevada nos valores do DDVE quando comparado a outros genótipos.

Para as medidas repetidas de dados categóricos, não houve variação significativa na classe funcional e nos genótipos D/I (p = 0,472) entre os grupos. Apenas quatro pacientes encontravam-se em classe funcional IV, a classe funcional II foi predominante na amostra, presente em 86 pacientes. Destes, 52,3% eram pertencentes ao genótipo DI.

No grupo B os pacientes apresentaram megaesôfago, porém não houve diferença no número de pacientes com e sem megaesôfago. A dislipidemia foi associada como um risco aumentado em 5 vezes para os portadores de IC. Os genótipos DD, DI e II não foram considerados como um fator de risco para IC, pois sua distribuição não foi estatisticamente diferente entre os grupos.

Discussão

A literatura é repleta de resultados conflitantes, permanecendo intenso o debate sobre a existência de quais seriam os polimorfismos implicados na susceptibilidade para o desenvolvimento ou agravamento da IC. No presente estudo, foi avaliado o papel do polimorfismo genético do gene ECA (D/I) em pacientes com IC de etiologia chagásica e pacientes portadores de doença de Chagas sem disfunção sistólica. Nesta população, não se encontrou associação do polimorfismo ECA com as características sociodemográficas e clínicas.

O gênero masculino foi predominante (63%) em nossa amostra, assim como em dados presente na literatura.9,10 A incidência de IC aumenta com a idade, sendo mais frequente em homens.11 O aumento da epidemia de IC na população masculina e idosa foi associado com maior sobrevida.12

Não houve diferença estatisticamente significativa na distribuição dos genótipos entre gênero masculino e feminino no grupo A, dado concordante com o estudo de Zhang et al.13

Dados presentes na literatura associaram o alelo D com a predisposição para HÁ.14-16 Estes dados contradizem os nossos achados. Os portadores de IC apresentaram valores de pressão arterial inferior ao grupo com doença de Chagas sem disfunção sistólica (p = 0,000), assim como nos resultados encontrados por Yang et al.,17 que investigaram os genótipos D/I em indivíduos de etnia chinesa. Não houve diferenças significativas na frequência dos alelos e genótipos entre os grupos de indivíduos em ambos os gêneros. Pacientes com IC e pressão arterial baixa tem maior risco de morte, mesmo com uso adequado de terapias farmacológicas.18

O genótipo DD foi associado de forma independente à pior evolução ecocardiográfica e o genótipo DI ao melhor perfil ecocardiográfico (aumento da fração de ejeção do VE e diminuição de diâmetros do VE).19 Nossos resultados são discordantes, pois, não foi verificado associação dos genótipos D/I com os parâmetros ecocardiográficos.

Mesmo pesquisando uma população com características diferentes, não encontramos nenhuma interação dos genótipos D/I com a IC. O mesmo achado já havia sido demonstrado em estudo20 que avaliou 241pacientes provenientes da Arábia Saudita. Após a realização da genotipagem para o polimorfismo do gene ECA não foi encontrada interação com a cardiopatia congênita.

A IC é uma condição clínica frequente que apresenta elevado grau de morbidade e mortalidade. Ela acomete 1,5% a 2,0% da população geral, porém sua prevalência aumenta progressivamente com a idade, atingindo aproximadamente 10% dos indivíduos com mais de 65 anos de idade.21 Esses dados confirmam nossos resultados, em que os pacientes com IC apresentaram idade significativamente superior aos pacientes com doença de Chagas sem disfunção sistólica.

Corroborando com nossos achados, Yang et al.,22 compararam a distribuição dos genótipos D/I em uma população de 701 indivíduos de ambos os gêneros. Nenhuma diferença foi encontrada na frequência dos genótipos e alelos em homens e mulheres entre um grupo de indivíduos com idade superior a 90 anos e um grupo controle com idade inferior a 60 anos.

Na análise dos genótipos D/I e do DSVE, não foi encontrada relação entre esses parâmetros. Nossos achados são discordantes de um estudo nacional23 em que encontraram aumento do DSVE em pacientes com o genótipo DD, associando-se com maior morbidade e mortalidade em pacientes com IC de diferentes etiologias.

Há uma possível interação do polimorfismo ECA na progressão da IC crônica.24 O alelo D foi associado com a progressão da IC e maior mortalidade quando comparado com o alelo I.24,25 Esses dados opõem-se aos resultados encontrados neste estudo, o qual os genótipos D/I não foram associados com a gravidade da IC.

O polimorfismo ECA não foi associado com a gravidade ou progressão da IC de etiologia chagásica. Corroborando com nossos dados, estudos anteriores26,27 não associaram o polimorfismo da ECA com desenvolvimento da IC ou progressão da cardiomiopatia chagásica.

Em nossa análise, a distribuição dos genótipos D/I foi semelhante entre os grupos A e B. Diferenças genéticas individuais podem levar a diversos perfis de riscos e número amostral pequeno, especialmente em estudos de associação, com poder inadequado para identificar contribuições genéticas, o que pode justificar uma discordância com os resultados encontrados.

Testes de análise do DNA podem fornecem a identificação de uma ou mais variantes genéticas associadas ao risco maior de IC e, assim, contribuir para medidas preventivas de mudanças de hábitos de vida e terapias que levem em conta o seu perfil genético.

Baseando-se no potencial de aplicabilidade do marcador genético na prática clínica e dos resultados inconclusivos acerca do papel do polimorfismo da ECA como fator de risco para o desenvolvimento da IC de etiologia chagásica, o uso desse marcador genético não foi útil para ser incorporado à prática clínica. A falta de associação entre os genótipos D/I pode indicar que o polimorfismo ECA não atua na patogênese da disfunção ventricular causada pela doença de Chagas.

Conclusão

Não houve diferença na frequência dos genótipos D/I nos pacientes portadores de IC de etiologia chagásica, quando comparados com os pacientes portadores e doença de Chagas sem disfunção sistólica. Não houve relação entre o polimorfismo ECA e as variáveis clínicas analisadas.

Limitações do estudo

O número de pacientes incluídos pode ser considerado pequeno se comparado ao valor estimado de portadores da doença existentes em nosso país. Aspectos socioeconômicos podem interagir com fatores genéticos e interferir nos desfechos da IC. Os achados neste estudo, em que apenas pacientes da rede pública foram estudados, podem impedir que os dados sejam reproduzidos em outras populações.

Serão necessários novos estudos, amplos e prospectivos com um grupo amostral maior, capazes de apontar estas e outras variáveis potencialmente relacionadas à IC de etiologia exclusivamente chagásica.

REFERÊNCIAS

1 Carvalho G, Rassi S, Bastos JMDA, Câmara SSP. Coronariopatia assintomática em chagásicos com insuficiência cardíaca: prevalência e fatores de risco. Arq. Bras. Cardiol. 2011,97(5):408-12. Doi: org/10.1590/50066-782X2011005000.103.
2 Nogueira PR, Rassi S, Corrêa KS. Perfil epidemiológico, clínico e terapêutico da insuficiência cardíaca em hospital terciário. Arq Bras Cardiol. 2010;95(3): 392-8. Doi: org/10.1590/50066-782X2010005000102.
3 Silva SJ. Estudo de polimorfismos genéticos em pacientes portadores de insuficiência cardíaca. (Dissertação) Goiânia: Universidade Federal de Goiás; 2012.
4 Carvalho APPF, Rassi S, Fontana KE, Correa KS, Feitosa RHF. Influência da suplementação de creatina na capacidade funcional de pacientes com Insuficiência Cardíaca. Arq Bras Cardiol. 2012,99(1):623-9. Doi: 10.1590/50066-782X2012005000056
5 Bocchi EA, Marcondes-Braga FG, Bacal F, Ferraz AS, Albuquerque D, Rodrigues D. Atualização da diretriz brasileira de insuficiência cardíaca crônica - 2012. Arq Bras Cardiol. 2012,98(1Suppl1):1-33.
6 Skrzynia C, Berg JS, Willis MS, Jensen BC. Genetics and heart failure: a concise guide for the clinician. Curr Cardiol Rev. 2015,11(1):10-7.PMID:24251456.
7 Cuoco MAR, Pereira AC, Mota GFA, Krieger JE, Mansur AJ. Polimorfismo genético, terapia farmacológica e função cardíaca sequencial em pacientes com insuficiência cardíaca. Arq. Bras. Cardiol. 2008,90(4):274-9. PMID:18516385.
8 Lindpaintner K, Pfeffer MA, Kreutz R, Stampfer MJ, Grodstein F, LaMotte F et al. A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med. 1995,332(11):706-11. Doi:10.1056/NEJM19950316321103.
9 Margoto G, Colombo RCR, Gallani MCBJ. Características clínicas e psicossociais do paciente com insuficiência cardíaca que interna por descompensação clínica. Rev Esc Enferm. 2009,43(4):44-53. PMID:19437853.
10 Silva JF, Giannini DT, Mourilhe-Rocha R. Metabolic syndrome in patients with chronic heart failure. Int J Cardiovasc Sci. 2015,28(3):206-14.Doi: 10.5935/2359-4802.20150030
11 Ho KK, Pinsky JL, Kannel WB, Levy D. The epidemiology of heart failure: the Framingham Study. J Amn Coll Cardiol. 1993, 22(4 Suppl A):6A-13A.
12 Barker WH, Mullooly JP, Getchell W. Changing incidence and survival for heart failure in a well-defined older population, 1970-1974 and 1990-1994. Circulation. 2006,113(6):799-805. Doi:10.1161/CIRCULATIONAHA.104.492033
13 Zhang YF, Cheng Q, Tang NL, Chu TT, Tomlinson B, Liu F, et al. Gender difference of serum angiotensin-converting enzyme (ACE) activity in DD genotype of ACE insertion/deletion polymorphism in elderly Chinese. Journal of the renin-angiotensin-aldosterone system: j renin Angiotensin Aldosterone Syst. 2014;15(4):547-52. Doi: 10.1177/1470320313475906.
14 Fatini C, Sticchi E, Marcucci R, Said AA, Del Pace S, Verdiani V, et al. ACE Insertion/Deletion, But Not −240A>T Polymorphism, Modulates the Severity in Heart Failure. J Investig Med. 2008,56(8):1004-10.Doi: 10.2310/JIM06013-3181828028.
15 Schut AF, Bleumink GS, Stricker BH, Hofman A, Witteman JC, Pols HA, et al. Angiotensin converting enzyme insertion/deletion polymorphism and the risk of heart failure in hypertensive subjects. Eur Heart J. 2004,25(23):2143-8. Doi: 10.1016/j.ehj.004.08.026.
16 Bahramali E, Rajabi M, Jamshidi J, Mousavi SM, Zarghami M, Manafi A, et al. Association of ACE gene D polymorphism with left ventricular hypertrophy in patients with diastolic heart failure: a case-control study. BMJ open. 2016,6(2):e010282.
17 Yang YL, Mo YP, He YS, Yang F, Xu Y, Li CC, et al. Correlation between renin-angiotensin system gene polymorphisms and essential hypertension in the Chinese Yi ethnic group. Journal of the renin-angiotensin-aldosterone system: J Renin Angiotensin Aldosterone Syst.2015,16(4):975-81. Doi; 10.1177/1470320315598697.
18 Gheorghiade M, Abraham WT, Albert NM, Greenberg BH, O'Connor CM, She L, et al. Systolic blood pressure at admission, clinical characteristics, and outcomes in patients hospitalized with acute heart failure. JAMA. 2006,296(18):2217-26. Doi:1001/jama.296182217.
19 Albuquerque FN, Brandao AA, Silva DA, Mourilhe-Rocha R, Duque GS, Gondar AF, et al. Angiotensin-converting enzyme genetic polymorphism: its impact on cardiac remodeling. Arq Bras Cardiol. 2014,102(1):70-9. Doi: 10.5935/abc20130229.
20 Alazhary NM, Morsy MM, Al-Harbi KM. Angiotensin-converting enzyme gene insertion deletion (ACE I/D) polymorphism in Saudi children with congenital heart disease. Eur Rev Med Pharmacol Sci. 2015,19(11):2026-30. PMID:26125265.
21 Carvalho Filho E, Curiati J. Como diagnosticar e tratar a insuficiência cardíaca no idoso. RBM. Rev Bras Med. 2001, 58(3):14.
22 Yang JK, Gong YY, Xie L, Lian SG, Yang J, Xu LY, et al. Lack of genetic association between the angiotensin-converting enzyme gene insertion/deletion polymorphism and longevity in a Han Chinese population. Journal of the renin-angiotensin-aldosterone system: J Renin Angiotensin Aldosterone Syst. 2009,10(2):115-8. Doi: 10.1177/1470320309104873.
23 Cuoco MA, Pereira AC, de Freitas HF, de Fatima Alves da Mota G, Fukushima JT, Krieger JE, et al. Angiotensin-converting enzyme gene deletion polymorphism modulation of onset of symptoms and survival rate of patients with heart failure. Int J Cardiol. 2005,99(1):97-103. Doi:: PMID 15721506
24 Huang W, Xie C, Zhou H, Yang T, Sun M. Association of the angiotensin-converting enzyme gene polymorphism with chronic heart failure in Chinese Han patients. Eur J Heart Fail. 2004,6(1):23-7. Doi; 10.1016/j.ejheart.2003.09.004
25 Wu CK, Luo JL, Tsai CT, Huang YT, Cheng CL, Lee JK, et al. Demonstrating the pharmacogenetic effects of angiotensin-converting enzyme inhibitors on long-term prognosis of diastolic heart failure. Pharmacogenomics J. 2010, 10(1):46-53. Doi: 10.1038/fpj.2009.39.
26 Pascuzzo-Lima C, Mendible JC, Bonfante-Cabarcas R. Polimorfismo I/D del gen de la enzima de conversión de angiotensina y progresión de la miocardiopatía chagásica. Rev Esp Cardiol. 2009, 62(03):320-2. Doi:10.1016/S0300-8932(09)70379-3
27 Silva S, Rassi S, Silva C. Ausência de associação do polimorfismo dos alelos D/I do gene da enzima conversora de angiotensina (ECA) em pacientes com insuficiência cardíaca. RBM. Rev Bras Med. 2015,72(4):130-5.
Política de Privacidade © Copyright, Todos os direitos reservados.