Polimorfismos IL-17A, MCP-1, CCR-2 e ABCA1 em crianças com doença hepática gordurosa não alcoólica

Polimorfismos IL-17A, MCP-1, CCR-2 e ABCA1 em crianças com doença hepática gordurosa não alcoólica

Autores:

Ulas Emre Akbulut,
Hamdi Cihan Emeksiz,
Senol Citli,
Alper Han Cebi,
Hatice Ayca Ata Korkmaz,
Gaye Baki

ARTIGO ORIGINAL

Jornal de Pediatria

versão impressa ISSN 0021-7557versão On-line ISSN 1678-4782

J. Pediatr. (Rio J.) vol.95 no.3 Porto Alegre maio/jun. 2019 Epub 01-Jul-2019

http://dx.doi.org/10.1016/j.jped.2018.03.005

Introdução

A doença hepática gordurosa não alcoólica (DHGNA) é uma doença hepática crônica causada pelo acúmulo excessivo de gordura no fígado, sem história de consumo crônico de álcool, doenças metabólicas do fígado (doença de Wilson) ou doenças hepáticas congênitas, virais ou autoimunes.1 A DHGNA está incluída em um amplo espectro de doenças hepáticas, variam de simples esteatose a esteato-hepatite, fibrose e até cirrose.1 A prevalência de DHGNA aumentou significativamente, devido à epidemia mundial de obesidade infantil nas duas últimas décadas.2 A DHGNA está intimamente ligada a um estilo de vida sedentário, aumento do índice de massa corporal (IMC) e adiposidade visceral em crianças, resultante do consumo excessivo de calorias.3 Vários estudos recentes relatam que, além dos fatores de risco ambientais, as variações genéticas individuais também podem contribuir para o desenvolvimento e a progressão da DHGNA.4

Vários genes candidatos foram implicados na patogênese da DHGNA, inclusive genes envolvidos no metabolismo lipídico hepático, sensibilidade à insulina e geração de espécies oxidantes reativas ou citocinas.5 Polimorfismos de nucleotídeo único em genes envolvidos no metabolismo lipídico (domínio de fosfolipase tipo-patatina-3 e lipina 1), estresse oxidativo (superóxido dismutase 2), sinalização de insulina (substrato receptor de insulina-1) e fibrogênese (fator Kruppel-like 6) foram associados à DHGNA em crianças.2 Além desses polimorfismos bem conhecidos, polimorfismos em genes que codificam proteínas envolvidas na patogênese da DHGNA também podem estar associados ao desenvolvimento da doença.

A proteína quimioatrativa de monócitos 1 (MCP-1), também chamada de quimiocina ligante 2 (CCL2), um forte fator quimiotático, desempenha um papel na ativação de monócitos, macrófagos e células T nas fases aguda e crônica da inflamação.6 O polimorfismo 2518 A / G no gene da MCP-1 afeta o nível de expressão da MCP-1 em resposta a estímulos inflamatórios e sabe-se que isso está associado a diabetes mellitus e várias doenças autoimunes.7,8 A MCP-1 exerce um efeito quimiotático sobre monócitos e células T através do receptor de quimiocinas 2 (CCR2).9 O polimorfismo 190 G/A no gene CCR também já foi associado ao desenvolvimento de DHGNA.10

O transportador-1 de cassete de ligação de ATP (ABCA1) é um membro da família de transportadores de membrana de cassete de ligação de ATP (ABC). A expressão de ABCA1 resultou em aumento do efluxo de colesterol e diminuição do conteúdo lipídico hepático.11 O estresse inflamatório aumenta o acúmulo de colesterol nos hepatócitos e inibe a expressão de ABCA1.12 Além disso, foi relatado que a diminuição da expressão hepática de ABCA1 pode causar esteato-hepatite em pacientes adultos com obesidade mórbida.11 A interleucina-17 (IL-17) é uma molécula pró-inflamatória produzida por células T-helper (Th) 17. Ela age como mediador da resposta imune contra patógenos bacterianos e fúngicos extracelulares e está envolvida no desenvolvimento de doenças inflamatórias e autoimunes.13 Também tem sido sugerido que a IL-17 tem um papel crítico no desenvolvimento de várias doenças hepáticas, como hepatite viral crônica, doenças autoimunes e doenças hepáticas alcoólicas.1416 Foi demonstrado que a IL-17A (-197 G / A) afeta o desenvolvimento da colite ulcerativa e da artrite reumatoide.17

O objetivo do nosso estudo foi investigar a associação entre DHGNA e polimorfismos em genes que codificam proteínas cujo papel na patogênese da DHGNA tem sido sugerido. Que seja de nosso conhecimento, a relação entre os quatro polimorfismos de nucleotídeo único e a DHGNA não foi estudada anteriormente.

Métodos

O estudo incluiu pacientes turcos obesos entre 10 e 17 anos, que se apresentaram na Clínica Pediátrica de Gastroenterologia, Hepatologia e Nutrição e Endocrinologia Pediátrica do Kanuni Training and Research Hospital entre junho de 2015 e julho de 2016. O paciente era considerado obeso se o escore z do IMC fosse ≥ 2 para idade e sexo.18 Os 186 pacientes incluídos no estudo foram separados em dois grupos. O grupo DHGNA (n = 101) incluiu pacientes com diagnóstico de DHGNA, níveis de alanina aminotransferase (ALT) acima do dobro do limite superior da normalidade (sexo masculino > 50 U/L, sexo feminino > 44 U/L) e doença hepática gordurosa detectada por ultrassonografia (USG).19 Pacientes com outras causas de doença hepática gordurosa, como a doença de Wilson, deficiência de α-1 antitripsina, hepatite autoimune e hepatite viral, foram excluídos. O grupo sem DHGNA (n = 85) incluiu pacientes obesos sem DHGNA (níveis normais de ALT e imagem USG do fígado normal), com medidas antropométricas, resistência à insulina e perfil lipídico semelhantes aos do grupo DHGNA. Nenhum dos pacientes no estudo foi submetido a biópsia hepática. Pacientes com doenças genéticas, endócrinas ou metabólicas que podem causar obesidade não foram incluídos no estudo. Além disso, nenhum dos pacientes apresentava doenças pró-inflamatórias comórbidas, como doença inflamatória intestinal.

O estudo foi feito após a aprovação do comitê de ética local (URL do Registro: 2015/27 Identifier: Trabzon Kanuni Training and Research Hospital Clinical Research Ethics Committee) e da obtenção do consentimento informado dos pais, de acordo com a Declaração de Helsinque.

Todos os participantes foram submetidos a exame físico. A altura foi medida até o centímetro mais próximo com um estadiômetro Harpenden (Holtain Limited, Crymych, Dyfed, País de Gales). O peso foi medido sem roupas até o 0,1 kg mais próximo, com uma balança calibrada. O índice de massa corporal (IMC) foi calculado através da fórmula peso (kg)/altura (m2). Os escores Z do IMC foram calculados com os valores de referência para crianças turcas.20 A proporção de gordura corporal foi calculada pelo método de bioimpedância elétrica (BIA) em um dispositivo Tanita BC 418 (Tanita Corporation, Tóquio, Japão). As medidas da cintura e da circunferência do quadril foram obtidas com uma fita métrica inelástica, enquanto o paciente permanecia de pé com os pés juntos (12-15 cm) e os braços ao lado do corpo. A relação cintura-quadril foi calculada dividindo-se a medida da cintura pela medida do quadril.

Após 10 horas de jejum, amostras de sangue venoso periférico foram obtidas para determinar os níveis de insulina (Beckman Coulter DXI 800, Califórnia, EUA), lipoproteína de alta densidade (HDL), lipoproteína de baixa densidade (LDL), triglicérides, colesterol total, alanina aminotransferase (ALT), aspartato aminotransferase (AST), gama glutamiltransferase (GGT) e glicose (Beckman Coulter AU5821, Califórnia, EUA). O modelo homeostático para resistência insulínica (HOMA-IR) foi calculado pela fórmula glicose × insulina (µU/mL)/405.21

Todos os exames foram feitos por dois radiologistas com mais de 10 anos de experiência em imagiologia abdominal pediátrica e esteatose hepática e os resultados foram determinados por consenso. Os radiologistas estavam cegos para os achados clínicos e resultados laboratoriais dos pacientes. A máquina de ultrassom usada foi a Aplio 500 (Toshiba Medical Systems, Otawara, Japão) com transdutores lineares de 4 a 9 MHz. Os pacientes foram avaliados em decúbito dorsal com o braço direito em abdução máxima. Os pacientes foram submetidos ao exame após um jejum de 4 horas. Imagens longitudinais do lobo hepático direito e do rim ipsilateral foram obtidas, inclusive os planos hepáticos sagitais. A graduação semiquantitativa de alterações gordurosas foi feita com os achados da USG de fígado gorduroso, perda de definição das margens vasculares e atenuação profunda com contraste fígado-rim.22

O DNA foi isolado do sangue periférico com o dispositivo automático QuickGene. Áreas alvo foram amplificadas por PCR com os pares primários: para MCP1 (2518 A/G) polimorfismo, F: 5' CTTTCCCTTGTGTGTCCCC 3', R: 5' TTACTCCTTTTCTCCCCAACC 3'; para CCR-2 rs1799864 polimorfismo, F: 5' ATTTCCCCAGTACATCCACAAC 3', R: 5' CCCACAATGGGAGAGTAATAAG 3'; para ABCA1rs4149313 polimorfismo, F: 5' GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 3', R: 5' AGAAAGGCAGGAGACAT CGCTT 3'; e para IL-17A rs2275913 polimorfismo, F: 5' AACAAGTAAGAATGAAAAGAGGACATGGT 3', R: 5' CCCCCAATGAGGTCATAGAAGAATC 3'.

O seccionamento foi feito com enzimas de restrição Pvull (Vivantis) para MCP1 (-2518 A/G) na atribuição do genótipo, enzimas de restrição FokL (Vivantis) para CCR-2 rs1799864 na atribuição do genótipo, enzimas de restrição Econl (Vivantis) para ABCA1 rs4149313 na atribuição do genótipo e enzimas de restrição BstENI para IL-17A rs2275913 na atribuição do genótipo. Após a separação por eletroforese em gel de agarose a 2%, a análise foi feita de acordo com o tamanho do produto. Para o controle, a precisão foi confirmada por análise de sequência aleatória de 10% em ambos os grupos.

Os dados foram avaliados com o software estatístico SPSS 13.0 (SPSS Inc., Chicago, IL, EUA). Os dados descritivos foram apresentados como média ± desvio-padrão (DP). A análise dos resultados foi feita com a distribuição percentual para dados qualitativos e mediana do intervalo interquartil (IIQ) ou média (desvio-padrão) para dados quantitativos. Para a comparação entre dois grupos, o teste t de amostras independentes pareadas foi usado para variáveis que apresentavam distribuição normal, enquanto o teste U de Mann Whitney foi usado para aquelas sem distribuição normal. No caso de mais de dois grupos, foi usado o teste Anova para variáveis com distribuição normal e o teste de Kruskal-Wallis para aquelas sem distribuição normal. O teste do qui-quadrado foi usado para comparar variáveis categóricas. A associação genotípica e odds ratio (OR) com intervalo de confiança de 95% (IC95%) foram estimados por análise de regressão logística binária. Em todos os casos, valores de p inferiores a 0,05 foram considerados estatisticamente significativos. A análise de potência foi feita com aproximação normal com o método de correção de continuidade do programa Open Epi, versão 3.01 (OpenEpi: Open Source Epidemiologic Statistics for Public Health, GA, EUA).

Resultados

As características demográficas, medidas antropométricas e dados laboratoriais dos pacientes são mostrados na tabela 1. Não foram encontradas diferenças entre os grupos em termos de idade e sexo, IMC, relação cintura/quadril ou proporção de gordura corporal. Além da ALT, as concentrações de AST e GGT também foram significativamente maiores no grupo DHGNA do que no grupo sem DHGNA (p < 0,05).

Tabela 1 Características dos grupos 

Parâmetros DHGNA (n = 101) Sem DHGNA (n = 85) p valor
Sexo, feminino, n (%) 45 (44,5) 36 (42,3) 0,88
Idade, anos 12,98 ± 2,26 13,31 ± 2,52 0,39
IMC, kg/m 2 30,07 ± 4,52 29,82 ± 4,57 0,94
Masculino 28,58 ± 3,94 29,11 ± 3,47 0,35
Feminino 29,04 ± 5,84 29,76 ± 4,94 0,89
z-escore IMC 2,38 ± 0,35 2,35 ± 0,30 0,09
Masculino 2,39 ± 0,35 2,42 ± 0,32 0,24
Feminino 2,36 ± 0,34 2,32 ± 0,29 0,13
Relação cintura-quadril 0,94 ± 0,04 0,92 ± 0,05 0,15
Masculino 0,95 ± 0,04 0,95 ± 0,03 0,10
Feminino 0,92 ± 0,04 0,91 ± 0,05 0,09
Gordura corporal total, % 35,95 ± 6,38 35,74 ± 5,73 0,64
Masculino 32,57 ± 6,34 32,51 ± 4,91 0,49
Feminino 39,26 ± 5,43 36,95 ± 5,32 0,73
ALT, U/L 54,0 (48,5-73,5) 19,0 (16,0-26,0) < 0,01
AST, U/L 46,0 (35,0-54,0) 21,0 (19,0-26,0) < 0,01
GGT, U/L 28,0 (22,0-37,0) 14,0 (12,0-18,0) < 0,01
Colesterol total, mg/dL 165,0 (141,5-180,5) 158,0 (145,7-173,0) 0,52
Triglicérides, mg/dL 111,0 (82,0-157,0) 105,0 (89,0-138,0) 0,80
HDL-colesterol, mg/dL 42,0 (36,0-52,0) 44,0 (38,0-52,0) 0,35
LDL-colesterol, mg/dL 100,0 (80,7-117,5) 91,0 (79,0-106,0) 0,28
HOMA-IR 4,63 ± 1,76 4,52 ± 1,50 0,10
Masculino 4,68 ± 1,62 4,65 ± 1,56 0,09
Feminino 4,44 ± 1,73 4,31 ± 1,89 0,13

ALT, alanina aminotransferase; AST, aspartato aminotransferase; DHGNA, doença hepática gordurosa não alcoólica; GGT, gama glutamiltransferase; HOMA-IR, avaliação do modelo homeostático para resistência insulínica; IMC, índice de massa corporal.Os valores são expressos como mediana (percentis 25 a 75) ou média ± desvio-padrão, conforme apropriado.

Não foram observadas diferenças entre os grupos em termos de genótipo e frequência alélica para os polimorfismos MCP-1 rs1024611, CCR-2 rs1799864 e ABCA1 rs4149313 (tabela 2). Dentre as quatro variantes, apenas o IL-17A rs2275913 foi associado à DHGNA. A porcentagem de genótipos IL-17A rs2275913 AA foi significativamente maior no grupo DHGNA do que no grupo sem DHGNA (p = 0,02, OR: 2,05, IC95%: 1,12-3,77). A frequência do alelo A de IL-17A rs2275913 foi significativamente maior no grupo DHGNA do que no grupo sem DHGNA (p = < 0,01). O poder do estudo foi calculado em 53%. Para esse poder (erro alfa: 0,05 e Df: 1), o tamanho do efeito foi calculado em 0,15.

Tabela 2 Frequência genotípica e alélica dos polimorfismos MCP-1 rs1024611, CCR-2 rs1799864, ABCA1 rs4149313, IL-17A rs2275913 em pacientes e análise de regressão logística de fatores preditivos para DHGNA 

Variável DHGNA (n = 101) (%) Sem DHGNA (n = 85) (%) p valora OR (IC95%)
MCP-1 AA (Sim) 26 (25,7) 25 (29,4) 0,58 0,83 (0,44-1,59)
(Não) (Ref) 75 (74,3) 60 (70,6)
AG (Sim) 36 (35,6) 32 (37,6) 0,78 0,91 (0,50-1,67)
(Não) (Ref) 65 (64,4) 53 (62,4)
GG (Sim) 39 (38,7) 28 (33,0)
(Não) 62 (61,3) 57 (77,0)
A 88 (43,5) 82 (48,2) 0,71 0,86 (0,60-1,24)
G (Ref) 114 (56,5) 88 (51,8)
CCR-2 AA (Sim) 6 (5,9) 5 (5,9)
(Não) (Ref) 95 (94,1) 80 (94,1)
AG (Sim) 6 (5,9) 13 (15,3) 0,06 0,35 (0,13-0,97)
(Não) (Ref) 95 (94,1) 72 (84,7)
GG (Sim) 89 (88,2) 67 (78,8) 0,08 2,05 (0,91-4,63)
(Não) (Ref) 12 (11,8) 18 (21,2)
A (Ref) 18 (9,0) 23 (13,6)
G 184 (91,0) 147 (86,4) 0,11 1,51 (0,87-2,64)
ABCA-1 AA (Sim) 33 (32,7) 28 (32,9) 0,97 0,83 (0,44-1,59)
(Não) (Ref) 68 (67,3) 57 (67,1)
AG (Sim) 39 (38,6) 34 (40,0) 0,85 0,91 (0,50-1,67)
(Não) (Ref) 62 (61,4) 51 (60,0)
GG (Sim) 29 (28,7) 23 (27,1)
(Não) 72 (71,3) 62 (72,9)
A 105 (51,9) 90 (52,9) 0,97 0,96 (0,67-1,50)
G (Ref) 97 (48,1) 80 (47,1)
IL-17A AA (Sim) 48 (47,5) 26 (30,6) 0,02 2,05 (1,12-3,77)
(Não) (Ref) 53 (52,5) 59 (69,4)
AG (Sim) 37 (36,6) 33 (38,8) 0,98 2,38 (0,55-1,88)
(Não) (Ref) 64 (63,4) 52 (61,2)
GG (Sim) 16 (15,9) 26 (30,6)
(Não) 85 (84,1) 59 (69,4)
A 133 (65,8) 85 (50,0) <0,01 1,78 (1,21-2,65)
G (Ref) 69 (33,2) 85 (50,0)

DHGNA, doença hepática gordurosa não alcoólica; IC, intervalo de confiança; OR, odds ratio; Ref, referência.

aComparado com o grupo de genótipos de referência, as diferenças nas frequências genotípicas foram analisadas com o teste do qui-quadrado. P < 0,05 foi considerado estatisticamente significante. Todos os quatro polimorfismos foram incluídos na análise de regressão logística multivariada ao mesmo tempo.Modelos: MCP-1 AA, genótipo AG e alelo A, CCR-2AG, genótipo GG e alelo G, ABCA-1 AA, genótipo AG e alelo A, IL-17A AA, genótipo AG e alelo A; Variável dependente: presença de DHGNA.Os valores em negrito referem-se a valores de p < 0,05.

A análise de regressão logística univariada mostrou que pacientes com o genótipo IL-17A rs2275913 AA tinham três vezes (IC 95%: 1,37-6,58; p ≤ 0,01) mais chance de ter DHGNA do que pacientes com o genótipo GG (tabela 3).

Tabela 3 Análise de regressão logística univariada de fatores preditivos para DHGNA 

Variável Estimativa de coeficiente EP OR (IC95%) p valor
IL-17A rs2275913 AA genótipoa 1,10 0,40 3,00 (1,37-6,58) < 0,01
IL-17A rs2275913 AG genótipo 0,60 0,40 1,82 (0,83-3,97) 0,13

DHGNA, doença hepática gordurosa não alcoólica; IC, intervalo de confiança; OR, odds ratio.

aO polimorfismo IL-17A rs2275913 tem os genótipos AA, AG e GG, enquanto o genótipo GG foi considerado como o grupo de referência.

As características clínicas e bioquímicas dos grupos em relação ao genótipo IL-17A rs2275913 são mostradas na tabela 4. Houve diferenças significativas nas concentrações de AST e ALT entre os três grupos (p = 0,04 e p = 0,04, respectivamente). As concentrações séricas de ALT e AST foram maiores no genótipo AA e menores no genótipo GG.

Tabela 4 Características básicas dos indivíduos nos genótipos de IL-17A rs2275913 

Variável AA (n = 74) AG (n = 70) GG (n = 42) p valora
Idade, anos 13,08 ± 2,35 13,02 ± 2,51 13,41 ± 2,25 0,71
Sexo, feminino, n (%) 34 (45,9) 30 (42,8) 17 (40,4) 0,53
IMC, kg/m2 29,14 ± 4,20 29,92 ± 4,91 31,59 ± 4,10 0,32
z escore-IMC 2,32 ± 0,32 2,36 ± 0,33 2,48 ± 0,30 0,24
Relação cintura-quadril 0,93 ± 0,05 0,93 ± 0,04 0,95 ± 0,05 0,12
Gordura corporal total, % 35,95 ± 5,54 35,73 ± 6,62 35,91 ± 6,48 0,98
ALT, U/L 49,5 (28,0-63,5) 41,0 (19,0-54,0) 34,0 (20,0-56,5) 0,04
AST, U/L 34,0 (25,7-51,0) 29,0 (21,5-46,0) 26,0 (20,0-46,0) 0,04
GGT, U/L 22,0 (15,7-30,2) 18,0 (14,0-29,0) 20,0 (14,0-38,0) 0,32
Colesterol total, mg/dL 162,0 (146,0-181,0) 163,0 (150,0-179,5) 159,0 (133,0-172,5) 0,06
Triglicérides, mg/dL 112,0 (84,7-165,7) 110,0 (86,0-142,5) 105,0 (87,5-138,5) 0,81
HDL-colesterol, mg/dL 46,0 (37,0-52,0) 44,0 (38,0-52,5) 46,0 (36,0-46,5) 0,10
LDL-colesterol, mg/dL 96,5 (77,5-119,5) 100,0 (81,0-114,0) 91,0 (81,0-111,0) 0,10
HOMA-IR 4,61 ± 1,78 4,53 ± 1,80 4,65 ± 2,17 0,40

ALT, alanina aminotransferase; AST, aspartato aminotransferase; GGT, gama glutamiltransferase; HOMA-IR, avaliação do modelo homeostático para resistência insulínica; IMC, índice de massa corporal.

aCalculado para as comparações entre os três grupos genotípicos com Anova para variáveis contínuas e o teste do qui-quadrado para variáveis categóricas.Os valores são expressos como mediana (percentis 25-75) ou média ± DP, como apropriado.Os valores em negrito referem-se a valores de p < 0,05.

Discussão

No presente estudo, avaliamos o efeito de quatro polimorfismos no desenvolvimento de DHGNA em crianças obesas. Encontramos o genótipo AA do gene IL-17A com maior frequência em crianças obesas com DHGNA do que em crianças obesas sem DHGNA. Entretanto, não houve diferenças significativas nos polimorfismos dos genes MCP-1 rs1024611, CCR-2 rs1799864 e ABCA1 rs4149313 em crianças turcas obesas com e sem DHGNA, sugeriu-se que esses polimorfismos não tiveram papel no desenvolvimento de DHGNA nas crianças obesas.

O equilíbrio entre os mecanismos pró-inflamatórios e anti-inflamatórios é de importância crítica para o desenvolvimento e a progressão da DHGNA. O estímulo de macrófagos pró-inflamatórios por mediadores pró-inflamatórios, tais como interferon-γ e lipopolissacarídeos, estimula a secreção de citocinas pró-inflamatórias, como TNFα, IL-6, IL-17 e IL-23, o que por sua vez causa danos hepáticos e metabólicos.23,24 Em contraste, as células T regulatórias (Treg) impedem a produção de citocinas pró-inflamatórias, como a IL-17, ao expressar citocinas anti-inflamatórias, como a IL-10, o que controla a inflamação.25 Em estudos experimentais, a ativação da via da IL-17 demonstrou que ela desempenha um papel significativo no desenvolvimento de DHGNA, na progressão da esteatose e na formação de fibrose.26

Sabe-se que o polimorfismo IL-17A rs2275913 é fortemente associado à secreção de IL-17 pelas células-T. No estudo in vitro de Espinoza et al., observou-se um nível mais elevado de secreção de IL-17 em células-T estimuladas de indivíduos com o alelo AA de IL-17A rs2275913 do que nos indivíduos sem o alelo.27 A ligação diferencial das variantes alélicas do polimorfismo IL-17A rs2275913 ao fator nuclear de células T ativadas (NFAT) tem sido proposta como responsável pelas diferenças na secreção de IL-17A.27 Várias doenças inflamatórias têm sido associadas clinicamente ao polimorfismo IL-17A rs2275913. Observou-se que o homozigoto rs2275913 AA apresenta risco aumentado de suscetibilidade à artrite reumatoide em populações caucasianas e colite ulcerativa em populações japonesas.28,29

No presente estudo, descobrimos que o polimorfismo IL-17A rs2275913 foi mais frequente em crianças obesas com DHGNA do que naquelas sem DHGNA. Um estudo anterior também relatou uma associação entre a concentração de IL-17 e a concentração de ALT em pacientes com infecção crônica pelo vírus da hepatite B, refletiu o grau de dano hepático.30 Consistentemente com essas observações, as concentrações séricas de ALT e AST diferiram significativamente entre os grupos de alelos de IL-17 rs2275913 (AA, AG e GG). As concentrações séricas de ALT e AST foram mais altas no genótipo AA e mais baixas no genótipo GG. Esses achados sugerem que o genótipo AA pode ser um fator de risco para o desenvolvimento de DHGNA em pacientes obesos.

Não encontramos diferenças significativas nos polimorfismos dos genes MCP-1 rs1024611, CCR-2 rs1799864 e ABCA1 rs4149313 entre crianças obesas com e sem DHGNA, isso indicou que esses polimorfismos não parecem desempenhar um papel no desenvolvimento da doença. No entanto, esses polimorfismos podem estar relacionados ao desenvolvimento de esteato-hepatite em crianças obesas, uma vez que não pudemos avaliar o grau de fibrose e inflamação hepática em nossos pacientes.

Este estudo tem algumas limitações. Primeiro, a população do estudo era relativamente pequena. Sabe-se que a frequência dos polimorfismos estudados varia entre as etnias. A estrutura étnica da população poderia afetar a prevalência dos polimorfismos. Portanto, não podemos generalizar nossos resultados para outras populações. Em segundo lugar, a DHGNA foi diagnosticada por ultrassonografia e pelos níveis elevados de transaminases, que são consideradas ferramentas imperfeitas para detectar esteatose. Nenhum dos pacientes em nosso estudo foi submetido a biópsia hepática ou exame com FibroScan®. Portanto, nem a fibrose nem a inflamação do fígado puderam ser avaliadas nos participantes. Consequentemente, a associação entre os polimorfismos e o grau de fibrose e inflamação não pôde ser avaliada. Terceiro, o efeito do polimorfismo IL-17A rs2275913 na transcrição gênica não foi investigado.

Em conclusão, os resultados deste estudo mostraram que o genótipo AA do gene IL-17A pode estar associado ao desenvolvimento da DHGNA. Esse polimorfismo pode servir como um preditor para a esteatose hepática e fornecer informações úteis para identificar potenciais alvos terapêuticos para o tratamento de doenças hepáticas em pacientes obesos. Diferentemente do IL-17A (-197 G / A) (rs2275913), nenhuma associação foi encontrada entre os polimorfismos MCP-1 (-2518 A/G) (rs1024611), CCR-2 (190 G/A) (rs1799864) e ABCA1 (883 G/A) (rs4149313) e DHGNA em crianças turcas obesas. Outros estudos de grande escala precisam ser feitos sobre a associação entre esses polimorfismos e a DHGNA, bem como a fibrose, em diferentes etnias, a fim de confirmar nossos achados.

REFERÊNCIAS

1 Vos MB, Abrams SH, Barlow SE, Caprio S, Daniels SR, Kohli R, et al. NASPGHAN clinical practice guideline for the diagnosis and treatment of nonalcoholic fatty liver disease in children: recommendations from the Expert Committee on NAFLD (ECON) and the North American Society of Pediatric Gastroenterology, Hepatology and Nutrition (NASPGHAN). J Pediatr Gastroenterol Nutr. 2017;64:319-34.
2 Nobili V, Donati B, Panera N, Vongsakulyanon A, Alisi A, Dallapiccola B, et al. A 4-polymorphism risk score predicts steatohepatitis in children with nonalcoholic fatty liver disease. J Pediatr Gastroenterol Nutr. 2014;58:632-6.
3 Feldstein AE, Charatcharoenwitthaya P, Treeprasertsuk S, Benson JT, Enders FB, Angulo P. The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years. Gut. 2009;58:1538-44.
4 Lin YC, Chang PF, Hu FC, Yang WS, Chang MH, Ni YH. A common variant in the PNPLA3 gene is a risk factor for non-alcoholic fatty liver disease in obese Taiwanese children. J Pediatr. 2011;158:740-4.
5 Hernaez R. Genetic factors associated with the presence and progression of nonalcoholic fatty liver disease: a narrative review. Gastroenterol Hepatol. 2012;35:32-41.
6 Harigai M, Hara M, Yoshimura T, Leonard EJ, Inoue K, Kashiwazaki S. Monocyte chemoattractant protein-1 (MCP-1) in inflammatory joint diseases and its involvement in the cytokine network of rheumatoid synovium. Clin Immunol Immunopathol. 1993;69:83-91.
7 Moon JY, Jeong L, Lee S, Jeong K, Lee T, Ihm CG, et al. Association of polymorphisms in monocyte chemoattractant protein-1 promoter with diabetic kidney failure in Korean patients with type 2 diabetes mellitus. Korean Med Sci. 2007;22:810-4.
8 Hwang SY, Cho ML, Park B, Kim JY, Kim YH, Min DJ, et al. Allelic frequency of the MCP-1 promoter -2518 polymorphism in the Korean population and in Korean patients with rheumatoid arthritis, systemic lupus erythematosus and adult onset Still's disease. Eur J Immunogenet. 2002;29:413-6.
9 Singh V, Srivastava N, Srivastava P, Mittal RD. Impact of CCL2 and its receptor CCR2 gene polymorphism in North Indian population: a comparative study in different ethnic groups worldwide. Indian J Clin Biochem. 2013;28:259-64.
10 Zhang C, Guo L. Interaction of polymorphisms of monocyte chemoattractant protein-1 receptor CCR2 gene 190A/G, nicotinamide adenine dinucleotide phosphate oxidase subunit p22phox gene C242T and cigarette smoking increases the risk of nonalcoholic fatty liver disease. Wei Sheng Yan Jiu. 2015;44:730-7.
11 Vega-Badillo J, Gutiérrez-Vidal R, Hernández-Pérez HA, Villamil-Ramírez H, León-Mimila P, Sánchez-Muñoz F, et al. Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects. Liver Int. 2016;36:1383-91.
12 Ma KL, Ruan XZ, Powis SH, Chen Y, Moorhead JF, Varghese Z. Inflammatory stress exacerbates lipid accumulation in hepatic cells and fatty livers of apolipoprotein E knockout mice. Hepatology. 2008;48:770-8.
13 Puel A, Doffinger R, Natividad A, Chrabieh M, Barcenas-Morales G, Picard C, et al. Autoantibodies against IL-17A, IL-17F, and IL-22 in patients with chronic mucocutaneous candidiasis and autoimmune polyendocrine syndrome type I. J Exp Med. 2010;207:291-7.
14 Zhao L, Qiu D, Ma X. Th17 cells: the emerging reciprocal partner of regulatory T cells in the liver. J Dig Dis. 2010;11:126-33.
15 Ye C, Li WY, Zheng MH, Chen YP. T-helper 17 cell: a distinctive cell in liver diseases. Hepatol Res. 2011;41:22-9.
16 Hammerich L, Heymann F, Tacke F. Role of IL-17 and Th17 cells in liver diseases. Clin Dev Immunol. 2011;2011:345803.
17 Arisawa T, Tahara T, Shibata T, Nagasaka M, Nakamura M, Kamiya Y, et al. The influence of polymorphisms of interleukin-17A and interleukin-17F genes on the susceptibility to ulcerative colitis. J Clin Immunol. 2008;28:44-9.
18 WHO Multicentre Growth Reference Study Group. WHO Child Growth Standards: length/height-for-age, weight-for-age, weight-for-length, weight-for-height and body mass index-for-age: methods and development. Geneva: World Health Organization; 2006.
19 Schwimmer JB, Newton KP, Awai HI, Choi LJ, Garcia MA, Ellis LL, et al. Paediatric gastroenterology evaluation of overweight and obese children referred from primary care for suspected non-alcoholic fatty liver disease. Aliment Pharmacol Ther. 2013;38:1267-77.
20 Neyzi O, Bundak R, Gökçay G, Günöz H, Furman A, Darendeliler F, et al. Reference values for weight, height, head circumference, and body mass index in Turkish children. J Clin Res Pediatr Endocrinol. 2015;7:280-93.
21 Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412-9.
22 Fu JF, Shi HB, Liu LR, Jiang P, Liang L, Wang CL, et al. Non-alcoholic fatty liver disease: an early mediator predicting metabolic syndrome in obese children?. World J Gastroenterol. 2011;17:735-42.
23 Fujisaka S, Usui I, Bukhari A, Ikutani M, Oya T, Kanatani Y, et al. Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. Diabetes. 2009;58:2574-82.
24 Vonghia L, Magrone T, Verrijken A, Michielsen P, Van Gaal L, Jirillo E, et al. Peripheral and hepatic vein cytokine levels in correlation with non-alcoholic fatty liver disease (NAFLD)-related metabolic, histological, and haemodynamic features. PLoS ONE. 2015;10:e0143380.
25 Wang Y, Lıu XP, Zhao ZB, Chen JH, Yu CG. Expression of CD4+ forkhead box P3 (FOXP3)+ regulatory T cells in inflammatory bowel disease. J Dig Dis. 2011;12:286-94.
26 Paquissi FC. Immune imbalances in non-alcoholic fatty liver disease: from general biomarkers and neutrophils to interleukin-17 axis activation and new therapeutic targets. Front Immunol. 2016;7:490.
27 Espinoza JL, Takami A, Nakata K, Onizuka M, Kawase T, Akiyama H, et al. A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation. PLoS ONE. 2011;6:e26229.
28 Nordang GB, Viken MK, Hollis-Moffatt JE, Merriman TR, Helgetveit K, et al. Association analysis of the interleukin 17A gene in Caucasian rheumatoid arthritis patients from Norway and New Zealand. Rheumatology (Oxf). 2009;48:367-70.
29 Hayashi R, Tahara T, Shiroeda H, Saito T, Nakamura M, Tsutsumi M, et al. Influence of IL17A polymorphisms (rs2275913 and rs3748067) on the susceptibility to ulcerative colitis. Clin Exp Med. 2013;13:239-44.
30 Zhang JY, Zhang Z, Lin F, Zou ZS, Xu RN, Jin L, et al. Interleukin-17-producing CD4(+)T cells increase with severity of liver damage in patients with chronic hepatitis B. Hepatology. 2010;51:81-91.
Política de Privacidade. © Copyright, Todos os direitos reservados.