Prevalência do Helicobacter pylori em amígdalas e adenoides

Prevalência do Helicobacter pylori em amígdalas e adenoides

Autores:

Tuba Bayindir,
Yuksel Toplu,
Baris Otlu,
Yusuf Yakupogullari,
Ozge Yildirim,
Mahmut Tayyar Kalcioglu

ARTIGO ORIGINAL

Brazilian Journal of Otorhinolaryngology

versão impressa ISSN 1808-8694versão On-line ISSN 1808-8686

Braz. j. otorhinolaryngol. vol.81 no.3 São Paulo maio/jun. 2015

http://dx.doi.org/10.1016/j.bjorl.2014.08.018

Introdução

O Helicobacter pylori (Hp) é um microrganismo espiral gram-negativo, microaerófilo, que coloniza a mucosa gástrica humana. É a causa mais frequente de úlceras gástricas e duodenais em seres humanos. A relação entre o Hp e algumas malignidades gastrointestinais também já foi demonstrada.1 Particularmente cepas positivas associadas à citotoxina do gene A (cagA) estão relacionadas com um risco significativamente maior de desenvolvimento de gastrite atrófica, linfoma associado ao tecido linfoide de mucosa (MALToma) e câncer gástrico. O Helicobacter pylori é geralmente adquirido na infância (< 10 anos) através de transmissão fecal-oral, oral-oral e gástrica-oral,2 - 5 e pode permanecer silencioso por toda a vida.3 , 6 A via de transmissão da infecção pelo Hp ainda não é foi claramente compreendida.

O anel de Waldeyer é o primeiro passo para a defesa da mucosa contra patógenos invasores através do seu conteúdo MALT. Os tecidos adenoideano e tonsilar fazem parte do anel de Waldeyer, e participam no sistema imunológico, especialmente em crianças. Por outro lado, a adenoidectomia e/ou tonsilectomia representam os procedimentos cirúrgicos mais comuns na infância, geralmente por infecção crônica e/ou hipertrofia.7

Embora o estômago seja um reservatório natural para o Hp, tem-se demonstrado que vários tecidos, como a vesícula biliar, a gengiva, as lesões bucais e a placa dentária, podem atuar como potenciais reservatórios extragástricos deste patógeno.8 , 9 Além disso, o Hp foi encontrado em pólipos nasais, mucosa nasal e saliva.10 Estudos recentes têm sugerido que o tecido adenotonsilar possa ser um reservatório extragástrico adicional para o Hp, mas os resultados têm sido conflitantes.5 , 8 , 11 - 15 A detecção da presença e colonização do Hp em diferentes regiões do corpo é particularmente importante para uma melhor compreensão dos modos de transmissão e progressão da infecção deste microorganismo. Neste estudo, nosso objetivo foi tentar esclarecer o papel do tecido adenotonsilar na infecção por Hp; se o tecido adenotonsilar é um reservatório extragástrico para o Hp ou se o Hp tem um papel na patogênese da adenotonsilite crônica.

Método

Pacientes

Esse estudo clínico foi realizado nos Departamentos de Otorrinolaringologia e Microbiologia Clínica da Universidade entre agosto de 2011 e agosto de 2012. Os tecidos adenotonsilares foram retirados cirurgicamente e amostras de soro foram coletadas de crianças submetidas a adenoidectomia e adenotonsilectomia por adenotonsilite crônica. Um total de 64 crianças (34 meninos, 30 meninas) foi incluído no estudo. A idade média dos pacientes foi de 5,9 anos, variando entre 1 e 17 anos. Um total de 84 amostras clínicas foi coletado dos pacientes. Sessenta e duas biópsias foram obtidas de tecido adenoideano e 22 de tecido tonsilar. Amostras de sangue venoso periférico (5-6 mL) foram coletadas de todos os pacientes.

Critérios de inclusão

As indicações cirúrgicas para adenoidectomia e adenotonsilectomia foram as seguintes: infecções tonsilares crônicas ou recorrentes (seis ou mais episódios de tonsilites por ano) para tonsilectomia, e hipertrofia de adenoide (70% ou mais de obstrução da coana nasal em exame endoscópico), causando sintomas obstrutivos, para adenoidectomia.7

Critérios de exclusão

Os pacientes que haviam tomado antibióticos, inibidores de bomba de prótons ou antagonistas dos receptores H2 e antiácidos por um período de até quatro semanas antes da cirurgia, bem como aqueles que apresentavam um histórico clínico de sintomas de dispepsia ou gastroesofágicos no questionário sistemático, foram excluídos do estudo. Todos os pacientes foram operados sob anestesia geral. Os tecidos e as amostras de soro foram armazenados a -70 °C até a realização da análise laboratorial.

Testes laboratoriais

Amostras de sangue venoso periférico (5-6 mL) foram coletadas de todos os pacientes. Em seguida, foram centrifugadas a 2.500 rpm durante 10 minutos. O soro foi separado e armazenado a -80 °C. As amostras de soro foram analisadas para Imunoglobulina G (IgG) do Hp usando um kit comercial de ensaio imunológico (Dima GmbH, Alemanha). Resumidamente, 250-500 µL de soro do paciente foi inserido no dispositivo de teste e os resultados foram lidos visualmente em 10 minutos, de acordo com as recomendações do fabricante. Este teste sorológico é um teste rápido, e nós o utilizamos para verificar a prevalência de exposição das crianças de nossa região ao Hp.

Extração de DNA

Amostras de tecido tonsilar e adenoideano foram fragmentadas mecanicamente utilizando o Tissue Lyser system (Qiagen, Hilden, Alemanha), e depois incubadas durante a noite em tampão de lise de tecido. O DNA bacteriano foi extraído a partir dessas amostras depois de completada a digestão dos tecidos, utilizando o QIAamp DNA Mini Kit (Qiagen), de acordo com as instruções do fabricante.

Polymerase Chain Reaction para detecção de DNA do H. pylori e gene CagA

Para a detecção de H. pylori e seu gene de virulência nas amostras clínicas, os genes glmM (gene fosfoglucosamina mutase) e CagA (citotoxina do gene A) foram estudados com um método de Polymerase Chain Reaction (PCR) in-house com primers anteriormente relatados.16 , 17 Um total de 25 µL de mistura de amplificação, consistindo de 12,5 µL de TopTaq ADN PCR Master Mix (QIAGEN, Hilden, Alemanha), 1 µL (10 pmoL/µL) de cada primer, 8 µL de H2O e 2,5 µL/cada produto da extração da amostra foram preparadas. As condições de amplificação e os conjuntos de primers são apresentados na tabela 1. Os produtos da PCR foram submetidos à eletroforese em 2% em gel de agarose; e então, o gel corado com brometo de etídio foi avaliado em um sistema de imagem de gel (Gel logic 2200 imaging system (1.708 × 1.280 pixels, Kodak Company, NY, EUA) (fig. 1).

Tabela 1  Primers de DNA utilizados no estudo e condições de amplificação 

Gene Sequência de Primer Produto da PCR Condições da PCR Referências
glmM 5’-AAGCTTTTAGGGGTGTTAGGGGTTT-3’ 294 bp 94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min (35 ciclos) 16
5’-AAGCTTACTTTCTAACACTAACGC-3’
CagA ATAATGCTAAATTAGACAACTTGAGCGA 298 bp 94 °C, 1 min; 60 °C, 1 min; 72 °C, 1 min (45 ciclos) 17
TTAGAATAATCAACAAACATCACGCCA

PCR, Polymerase Chain Reaction.

Figura 1  gene glmM (294 bp) é mostrado no gel de agarose (2%). Colunas 1, 2, 5 e 8 mostram amostras positivas. A coluna 11 é o controle positivo; a coluna 12 é o controle negativo; as colunas 3, 4, 6, 7, 9, 10 são amostras negativas. A coluna M mostra os marcadores de peso molecular (DNA molecular Weight Marker IX, Roche). 

A análise pelo PCR foi realizada em tecidos tonsilares e adenoideanos selecionados aleatoriamente.

Considerações éticas

Esse estudo foi realizado após a aprovação do comitê de ética humana da universidade. Os formulários de consentimento foram assinados pelos pais dos pacientes antes da coleta das amostras de sangue e tecido.

Resultados

Amostras de sangue venoso periférico (5-6 mL) foram coletadas de todos os pacientes. Um total de 57 amostras de soro de 64 pacientes (89%) foi considerado positivo para H. pylori IgG. A média de idade e sexo dos pacientes foi de 6,3 anos (3-17 anos), sendo 32 meninos e 25 meninas, respectivamente.

Na análise de PCR, sete amostras clínicas pertencentes a diferentes pacientes do grupo de 64 pacientes, (10,9%) foram positivas para o DNA do Hp. Uma imagem representativa do gel é mostrada na figura 1. Dessas amostras, duas eram tonsilares e as cinco restantes de adenoides de diferentes pacientes. O gene de virulência cagA foi positivo em todos os tecidos positivos para Hp. Observamos que 10,9% dos pacientes foram positivos para Hp, e 90% desses pacientes foram positivos para Hp IgG.

Discussão

A infecção pela Helicobacter pylori é disseminada em todo o mundo, e a prevalência da infecção pode variar de acordo com o nível socioeconômico dos pacientes, área geográfica, idade e etnia. Sua prevalência é de cerca de 30-40% nos países desenvolvidos, enquanto que a taxa é de até 90% em países em desenvolvimento ou subdesenvolvidos.18 - 21

A presença da Hp no trato aerodigestivo superior tem sido relatada em diferentes estudos. Minocha et al. relataram uma baixa prevalência de Hp na mucosa gástrica de pacientes com histórico de tonsilectomia.9 Suspeita-se que o Hp colonize o tecido tonsilar e/ou o tecido adenoide como um reservatório extragástrico. No entanto, Di Bonoventura não confirmou essa opinião, e afirmou que as tonsilas não representam um reservatório para o Hp.,22 demonstrando que ainda existem contradições nas investigações recentes. Além disso, alguns estudos propuseram que o Hp pode ter um papel na patogênese da adenotonsilite crônica. A progressão do processo patogênico da adenotonsilite crônica, a partir de uma única infecção até a cronificação, ainda não foi claramente compreendida. Acredita-se que a obstrução da cripta tonsilar pela infecção possa levar a uma diferenciação da flora habitual para algumas bactérias patogênicas.2 , 23 , 24 Em nosso estudo, o gene de virulência cagA foi positivo em todos os pacientes positivos para DNA do Hp na análise por PCR. Nossos resultados apoiam a ideia que o Hp possa ter um papel na patogênese da adenotonsilite crônica, especialmente em regiões endêmicas como a Turquia, onde esse estudo foi realizado.

A cultura bacteriana é um método valioso de diagnóstico para infecções pelo Hp., mas a natureza fastidiosa do Hp acaba ocasionando resultados falso-negativos frequentes. Por isso, vários outros métodos têm sido utilizados para o diagnóstico da infecção por Hp. A técnica de nested-PCR tem sido particularmente preferida quando se trata de detectar o Hp na prática clínica, por sua alta sensibilidade e especificidade.15 Em geral, métodos mais precisos de diagnóstico como a imuno-histoquímica e PCR têm sido mais utilizados. Ainda não existe um teste único que seja aceito como o padrão-ouro para detecção de H. pylori. O uso de testes combinados ainda é preferido, tanto em estudos pediátricos quanto em adultos.1 , 25 No presente estudo usamos sorologia para indicar a maior prevalência de exposição ao Hp na população pediátrica local e a técnica de nested-PCR (método mais sensível) para detectar o Hp em amostras de tecido.

Bitar et al. testaram 25 amostras de tecido adenoideano usando o teste rápido da urease (TRU), avaliação histológica e a técnica nested-PCR.12 Eles relataram uma taxa de positividade de 84% para Hp nas adenoides com o TRU. No exame histopatológico, outras bactérias foram encontradas, 68% em tecidos TRU-positivos, enquanto que apenas 16% eram microrganismos como o Hp. Por fim, os autores relataram que todas as suas amostras foram negativas para DNA do Hp no nested-PCR. Por isso, eles concluíram que o nested-PCR era o melhor método para diagnosticar o Hp. Da mesma forma, Toros et al. testaram 84 amostras de tecidos adenoideanos e tonsilares por TRU e avaliação histopatológica.13 Eles não detectaram Hp em qualquer uma das amostras, tanto por TRU quanto pela histopatologia. Por isso, eles concluíram que a colonização de Hp em tecido tonsilar e/ou tecido adenoideano era improvável.

Vilarinho et al. tiveram como objetivo determinar se o tecido adenotonsilar poderia constituir um reservatório extragástrico para o Hp.14 Eles utilizaram diferentes métodos diagnósticos, incluindo o TRU, imuno-histoquímica com um anticorpo anti-Hp policlonal, hibridização fluorescente in situ (FISH) com uma sonda de ácido nucleico peptídico (ANP) específica para o Hp e o PCR-DNA ELISA concebido para a detecção do gene vacA do microorganismo. Os anticorpos anti-Hp foram detectados em 39% dos pacientes. A imuno-histoquímica foi positiva em três tecidos tonsilares cujas sorologias foram negativas. O teste TRU foi positivo em dois tecidos adenoideanos e dois tecidos tonsilares com sorologia positiva. Os testes PNA-FISH e PCR-DNA ELISA, considerados os métodos mais específicos e sensíveis para detecção do Hp, tiveram resultados negativos em todos os tecidos. De acordo com os resultados, os pesquisadores concluiram que os tecidos adenotonsilares não constituiam um reservatório extragástrico em crianças para a infecção por Hp.

Em contraste com os estudos acima mencionados, Abdel-Monem et al. encontraram resultado positivo para Hp em tecido adenotonsilar utilizando PCR com a sequência do gene ure C em 16,6% dos pacientes.11 Um total de 30 amostras cirúrgicas (20 tonsilares e 10 adenoideanas de 20 pacientes) foi avaliado por TRU, sorologia e PCR. Eles relataram que o TRU foi positivo em 16 amostras (53,3%), e a sorologia foi positiva para anticorpos IgG do Hp em quatro pacientes (20%). Eles concluíram que os tecidos adenotonsilares poderiam ser uma área de reservatório extragástrico para a infecção por Helicobacter pylori em crianças com doenças adenotonsilares crônicas.

O gene cagA demonstrou estar presente em 60%-70% das cepas de Hp, que são aceitas como virulentas.26 A proteína cagA interage com as proteínas celulares e, consequentemente, pode causar lesões morfológicas no epitélio e falha na secreção e na transmissão de sinal das células humanas. Dessa forma, essas cepas são muito mais potentes para causar danos na mucosa gástrica.26 , 27

No presente estudo, verificou-se que 10,9% das crianças com adenotonsilite crônica eram positivas para o Hp, e 90% desses pacientes eram positivos para IgG do Hp. Apesar de ter sido uma valiosa ferramenta de diagnóstico em amostras gástricas, nós preferimos não usar o TRU em nosso estudo, uma vez que apresenta altas taxas de resultados falso-positivos, em consequência do intenso acúmulo de urease positiva presente na flora bacteriana normal do trato aerodigestivo superior. A cultura bacteriana pode ser uma valiosa ferramenta de diagnóstico, mas por causa da baixa capacidade de crescimento do Hp em materiais com uma alta carga bacteriana na flora, não a utilizamos. A detecção do DNA bacteriano e o seu gene de virulência foram escolhidos para investigar as bactérias em tecido adenotonsilar. Observamos que o Hp estava presente em 8% e 9% das adenoides e tonsilas, respectivamente. Em relação aos estudos previamente publicados, encontramos uma alta taxa de Hp em nossas amostras. Acreditamos que isso tenha ocorrido provavelmente devido à alta frequência desse microorganismo em nossa população. Além disso, observou-se que todas as amostras positivas para Hp também eram simultaneamente positivas para o gene cagA.

Conclusão

À luz dos resultados do estudo, pode-se argumentar que o Hp é capaz de colonizar os tecidos adenoideano e tonsilar de crianças com adenotonsilite crônica. Neste estudo piloto não separamos as crianças em grupos de acordo com a causa da indicação cirúrgica. Foram coletados os tecidos e amostras de soro de pacientes submetidos à adenoidectomia por hipertrofia, e tonsilectomia por infecções crônicas ou recorrentes. Percebemos que esse ponto constitui uma lacuna em nosso estudo. Outros estudos são necessários para mostrar se o Hp coloniza o tecido adenotonsilar temporariamente ou se tem um papel na patogênese da adenotonsilite crônica.

REFERÊNCIAS

Lawson AJ. Helicobacter. In: Versalovic J, Carroll KC, Funke G, et al., editors. Manual of clinical microbiology. Washington, DC: ASM Press; 2011. p. 900-15.
Cirak MY, 0zdek A, Yilmaz D, Bayiz U, Samim E, Turet S. Detec- tion of Helicobacter pylori and its CagA gene in tonsil and adenoid tissues by PCR. Arch 0tolaryngol Head Neck Surg. 2003;129:1225-9.
Azevedo NF, Guimaraes N, Figueiredo C, Keevil CW, Vieira MJ. A new model for the transmission of Helicobacter pylori: role of environmental reservoirs as gene pools to increase strain diversity. Crit Rev Microbiol. 2007;33:157-69.
Azevedo NF, Huntington J, Goodman KJ. The epidemiology of Helicobacter pylori and public health implications. Helicobac- ter. 2009;14:1-7.
Vayisoglu Y, 0zcan C, Polat A, Delialioglu N, Gorur K. Does Helicobacter pylori play a role in the development of chronic adenotonsillitis? Int J Pediatr 0torhinolaryngol. 2008;72:1497-501.
Bujanover Y, Reif S, Yahav J. Helicobacter pylori and pep- tic disease in the pediatric patient. Pediatr Clin North Am. 1996;43:213-34.
Suurna MV. Management of adenotonsillar disease. In: Lalwani AK, editor. Current diagnosis and treatment in otolaryngology- head and neck surgery. New York: McGraw-Hill; 2012. p. 362-76.
Jabbari MY, Rafeey M, Radfar R. Comparative assessment of Helicobacter pylori colonization in children tonsillar tissues. Int J Pediatr 0torhinolaryngol. 2009;73:1199-2201.
Minocha A, Raczkowski CA, Richards RJ. Is a history of tonsil- lectomy associated with a decreased risk of Helicobacter pylori infection? J Clin Gastroenterol. 1997;25:580-2.
Nguyen AM, Engstrand L, Genta RM, Graham DY, el-Zaatari FA. Detection of Helicobacter pylori in dental plaque by reverse transcription-polymerase chain reaction. J Clin Micro- biol. 1993;31:783-7.
Abdel-Monem MH, Magdy EA, Nour YA, Harfoush RA, Ibreak A. Detection of Helicobacter pylori in adenotonsillar tissue of chil- dren with chronic adenotonsillitis using rapid urease test PCR and blood serology: a prospective study. Int J Pediatr 0torhino- laryngol. 2011;75:568-72.
Bitar MA, Soweid A, Mahfouz R, Zaatari G, Fuleihan N. Is Heli- cobacter pylori really present in the adenoids of children? Eur Arch 0torhinolaryngol. 2005;262:987-92.
Toros SZ, Toros AB, Kaya KS, Deveci I, Özel L, Naibo?glu B, et al. A study to detect Helicobacter pylori in adenotonsillar tissue. Ear Nose Throat J. 2011;90:E32.
Vilarinho S, Guimaraes NM, Ferreira RM, Gomes B, Wen X, Vieira MJ, et al. Helicobacter pylori colonization of the adeno- tonsillar tissue: fact or fiction? Int J Pediatr 0torhinolaryngol. 2010;74:807-11.
Eyigor M, Eyigor H, Gultekin B, Aydin N. Detection of Helicobac- ter pylori in adenotonsiller tissue specimens by rapid urease test and polymerase chain reaction. Eur Arch 0torhinolaryngol. 2009;266:1611-3.
Lu JJ, Perng CL, Shyu RY, Chen CH, Lou Q, Chong SK, et al. Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues. J Clin Microbiol. 1999;37:772-4.
Hamlet A, Thoreson AC, Nilsson 0, Svennerholm AM, 0lbe L. Duodenal Helicobacter pylori infection differs in cagA genotype between asymptomatic subjects and patients with duodenal ulcers. Gastroenterology. 1999;116:259-68.
Khalifa MM, Sharaf RR, Aziz RK. Helicobacter pylori: a poor man's gut pathogen? Gut Pathog. 2010;2:2-12.
Agirdir BV, Bozova S, Derin AT, Turhan M. Chronic otitis media with effusion and Helicobacter pylori. Int J Pediatr 0torhino- laryngol. 2006;70:829-34.
Lukes P, Astl J, Pavlik E, Potuzníková B, Sterzl I, Betka J. Helicobacter pylori in tonsillar and adenoid tissue and its possible role in oropharyngeal carcinogenesis. Folia Biologica. 2008;54:33-9.
Zahedi MJ, Moghadam SD, Mosavi MA, Mirshekari T, Hayatbakhsh M. Helicobacter pylori colonization in biopsies of the adenoton- sillectomy specimens. Am J Applied Sci. 2009;6:2050-3.
di Bonaventura G, Neri M, Neri G, Catamo G, Piccolomini R. Do tonsils represent an extragastric reservoir for Helicobacter pylori infection. J Infect. 2001;42:221-2.
Brook I, Yocum P, Foote PA Jr. Changes in the core tonsillar bacteriology of recurrent tonsillitis: 1977-1993. Clin Infect Dis. 1995;21:171-6.
Skinner LJ, Winter DC, Curran AJ, Barnes C, Kennedy S, Maquire AJ, et al. Helicobacter pylori and tonsillectomy. Clin 0tolaryngol Allied Sci. 2001;26:505-9.
0gata SK, Kawakami E, Patricio FR, Pedroso MZ, Santos AM. Eval- uation of invasive and non-invasive methods for the diagnosis of Helicobacter pylori infection in symptomatic children and adolescents. Sao Paulo Med J. 2001;119:67-71.
Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12:30-6.
Hatakeyama M. SagA of CagA in Helicobacter pylori pahogene- sis. Curr 0pin Microbiol. 2008;11:30-7.
Política de Privacidade © Copyright, Todos os direitos reservados.