Relação entre Periodontite, Polimorfismos Genéticos e Doença Arterial Coronariana no Sul do Brasil

Relação entre Periodontite, Polimorfismos Genéticos e Doença Arterial Coronariana no Sul do Brasil

Autores:

Luiz Otavio Rocha,
Eduarda Rocha,
Guilherme de Menezes Succi,
Rui Barbosa de Brito Junior

ARTIGO ORIGINAL

Arquivos Brasileiros de Cardiologia

versão impressa ISSN 0066-782Xversão On-line ISSN 1678-4170

Arq. Bras. Cardiol. vol.114 no.2 São Paulo fev. 2020 Epub 20-Mar-2020

https://doi.org/10.36660/abc.20180296

Resumo

Fundamento:

A periodontite e a doença arterial coronariana (DAC) compartilham uma etiologia inflamatória. Existe preocupação na investigação de associação entre essas duas condições. Há citocinas e proteínas com papel importante neste processo, como a proteína C-reativa (PCR) e a interleucina 6 (IL-6), que são derivados inflamatórios produzidos na presença da periodontite e na fisiopatologia da DAC. Os polimorfismos da PCR+1444 C > T e da IL-6 -174 G > C são reconhecidos na literatura como relacionados à DAC.

Objetivo:

Este estudo objetiva comprovar a associação entre periodontite e DAC, através da presença dos polimorfismos da PCR e da IL-6.

Métodos:

Foram selecionados 80 pacientes que se submeteram ao cateterismo diagnóstico no Hospital Universitário da Universidade Federal de Santa Maria (UFSM). A periodontite foi determinada pelo índice periodontal comunitário; a DAC, pelo laudo médico. Foi coletado o ácido desoxirribonucleico (DNA) pela saliva e estabelecido o polimorfismo pela avaliação da PCR/RFLP. Foi adotado um nível de significância estatística de 5%.

Resultados:

A idade mediana de todos os participantes (p = 0,035; OR 2,65; IC 95% [1,02-6,87]), gênero masculino (p = 0,012; OR 3,37; IC 95% [1,28-8,9]), periodontite (p = 0,013; OR 3,66; IC 95% [1,27-10,5]), polimorfismo da PCR +1444 C > T (p = 0,001; OR 6,37; IC 95% [2,25-17,9]) e polimorfismo da IL-6 -174G > C (p = 0,025; OR 2,87; IC 95% [1,09-7,55]) foram estatisticamente relacionados à DAC. Após ajuste com a regressão logística, mantiveram-se independentemente associadas à DAC a idade maior que 60 anos e o polimorfismo da PCR +1444 C > T.

Conclusões:

O polimorfismo da PCR +1444 C > T, neste estudo, esteve independentemente relacionado à DAC.

Palavras-chave: Periodontite; Polimorfismo Genético; Doença da Artéria Coronariana; Proteína C-Reativa; Epidemiologia

Abstract

Background:

Periodontitis and coronary artery disease (CAD) share an inflammatory etiology; there is a recent concern regarding the investigation of an association between these two conditions. Current theories indicate that cytokines and proteins have an important role in this process. C-reactive protein and interleukin-6 are inflammatory derivatives produced in the presence of periodontitis and in the pathophysiology of coronary disease. The polymorphisms of CRP + 1444 C > T and IL6-174 G > C are recognized in the literature as being related to CAD.

Objective:

This study investigates the association between periodontitis and coronary artery disease, through the presence of PCR and IL-6 polymorphisms.

Methods:

We selected 80 patients who underwent diagnostic catheterization in the HU of UFSM. The presence of periodontitis was determined by the Community Periodontal Index, whereas the CAD was established by the medical report. DNA was collected from a saliva sample and the presence of polymorphism was determined by PCR and restriction enzymes. A significance level of 5% was adopted.

Results:

The mean age of all participants (p = 0.035, OR 2.65; 95%CI: (1.02-6.87) male gender (p = 0.012, OR 3.37; 95% CI: (1.28- (p = 0.013, OR 3.66; 95% CI: (1.27-10.5)), PCR polymorphism + 1444C > T (p = 0.001, OR 6.37; 95% CI:, (2.25-17.9)) and IL6 -174 G > C polymorphism (p = 0.025, OR 2.87, 95% CI: (1.09-7.55)) were statistically associated with the presence of CAD. Age > 60 years and presence of the PCR +1444 C > T polymorphism remained independently associated with CAD after adjustment by logistic regression.

Conclusions:

The presence of the PCR + 1444 C > T polymorphism in this study was independently associated with the presence of coronary artery disease.

Keywords: Periodontitis; Polymorphism, Genetic; Coronary Artery Disease; C-reactive Protein; Epidemiology

Introdução

Periodontite é uma doença inflamatória crônica, desencadeada por bactérias componentes do biofilme dental, que causa destruição dos tecidos de suporte do dente,1-3 com alta prevalência em todo mundo.4 A periodontite estimula por meio do sistema imune, localmente e em sítios distantes, concentrações elevadas de citocinas e proteínas pró-inflamatórias, bem como bacteremia e endotoxemia, em virtude das bactérias que se proliferam nessa região.5

A doença arterial coronariana (DAC) é uma condição inflamatória crônica, complexa, multifatorial, contínua, formada pelo acúmulo de placas ateromatosas na camada íntima das artérias coronarianas,6-9 sendo responsável pelas síndromes coronarianas agudas, principal causa de morte no hemisfério ocidental.6,7

Em geral, as inflamações desempenham um papel muito importante tanto na periodontite como na DAC. Com o intuito de ligar estas duas condições, foram desenvolvidas duas teorias biologicamente plausíveis, com foco nas atuações direta e indireta das bactérias orais presentes na periodontite junto aos mediadores inflamatórios e pró-aterogênicos.1,2,4,10-14

Com base nas teorias inflamatórias e imunológicas, vários estudos têm sido conduzidos com o objetivo de relacionar essa associação ao fator genético, pela presença de polimorfismos, nos genes que expressam a produção desses fatores e são relacionados à periodontite, como a proteína C-reativa (PCR) e a interleucina 6 (IL-6).15-19

O polimorfismo de nucleotídio simples (SNP) do gene promotor da IL-6 pode afetar a produção e a expressão dessa citocina, consequentemente, esta alteração nos níveis séricos pode resultar em resposta biológica relevante.18 Tem sido demonstrada a associação entre a variante SNP -174G > C (rs 1800795) e o aumento do risco de doenças inflamatórias, como a DAC.17,20

Estudos apontam para o SNP rs 1136804, também representado como 3’ UTR +1444 C > T, como o polimorfismo com maiores associações a DAC.15,17

As altas incidências de periodontite, o elevado risco de mortalidade da DAC e uma lacuna de trabalhos nesta área motivaram a condução deste estudo buscando evidências da associação entre periodontite e DAC, pela comprovação dos polimorfismos da PCR e IL-6.

Métodos

A amostra considerou 80 pacientes (idade média 60,5 ± 10,5) que se submeteram a cateterismo cardíaco diagnóstico no laboratório de hemodinâmica do Hospital Universitário da Universidade Federal de Santa Maria (HU-UFSM) no período de 01 de setembro de 2010 até 30 de março de 2011 e que concordaram em participar do experimento assinando o termo de consentimento livre e esclarecido.

Foram excluídos da análise os pacientes tabagistas, diabéticos, portadores de doenças autoimunes, aqueles que tinham menos de dois dentes presentes em um dos sextantes, bem como os que não concordaram em participar do estudo.

O estudo foi aprovado pelo Comitê de Ética e Pesquisa do Centro de Pesquisas Odontológicas São Leopoldo Mandic, em 26/11/2014, CAAE: 35879614.7.0000.5374.

O exame periodontal foi executado pelo próprio pesquisador, que utilizou o índice periodontal comunitário (IPC) e o índice de perda de inserção periodontal (PIP) preconizados pela Organização Mundial da Saúde.21 O uso destes índices foram justificados pela imobilização parcial do paciente no leito e o curto espaço de tempo em que o mesmo ficou à disposição do examinador. Pacientes com escore IPC 3 ou 4 e escore PIP acima de 1 foram considerados portadores de periodontite.

O DNA foi coletado da saliva por meio de um bochecho com solução de glicose a 3% durante 1 minuto. Em seguida o material foi depositado em tubos de ensaio esterilizados com tampa e congelados a −20°C.22

O diagnóstico da DAC foi confirmado pelo cateterismo cardíaco, via punção femoral ou radial, realizado pelos médicos do laboratório de hemodinâmica do HU-UFSM. Foram considerados pacientes com DAC aqueles que apresentaram laudo médico positivo para presença de estenose coronariana.

Genotipagem

As amostras de saliva contaram com DNA coletado por meio de kit de extração de DNA genômico (Norgen Biotek Corp, Canadá). Realizou-se a amplificação dos genes pela reação em cadeia da polimerase utilizando os seguintes pares de iniciadores para a PCR +1444 - forward 5’, AGCTCGTTAACTATGCTGGGGCA-3’, e reverse 5, CTTCTCAGCTCTTGCCTTATGAGT - 3’, com temperatura de anelamento de 60°C; e para o IL-6 -174 - forward 5’, AACCTAATTCTACCCCCCTTGG-3, e reverse 5’, CAGAGGCAGCCGAAGAGTT-3’, com temperatura de anelamento de 59°C.17

A amplificação ocorreu através de um ciclo de 95°C por 3 minutos, 29 ciclos de 95°C por 1 minuto, com temperatura de anelamento variando conforme citado, por 1 minuto, 72°C por 1 minuto e um ciclo de 72°C por 10 minutos, realizada em termociclador automático.

Os resultados da reação em cadeia da polimerase foram digeridos pelas enzimas Sdul (Thermo Fischer Scientific, Massachusetts, USA) para PCR +1444 e HaeIII (Thermo Fischer Scientific, Massachusetts, USA) para IL-6 -174, nas quantidades especificadas pelo fabricante, no processo de polimorfismo de restrição de tamanho de fragmento. Os fragmentos resultantes foram identificados por eletroforese em gel de poliacrilamida a 8% corado por nitrato de prata. As análises genéticas foram executadas em julho de 2017 no laboratório de biologia molecular da Faculdade São Leopoldo Mandic, Campinas, SP.

Análise estatística

As variáveis foram apresentadas de forma categorizada: a DAC como presente ou ausente; a periodontite como presente ou ausente; a idade como maior ou igual a 60 anos ou menor ou igual a 59 anos; o gênero como masculino ou feminino; a raça como branca ou não branca, o sobrepeso e obesidade como com IMC maior ou igual a 25 e menor ou igual a 24; e os polimorfismos pela presença ou ausência do alelo de risco. O desfecho foi a presença ou ausência de DAC.

Foi utilizado um nível de significância de 5% (p < 0,05).

A amostra foi dividida em dois grupos de acordo com a presença da DAC: grupo-caso com 52 pacientes (idade média de 62,8 ± 11,2) e grupo-controle com 28 pacientes (idade média de 56,2 ± 8,8).

A distribuição dos genótipos dos dois SNP foi testada para o equilíbrio de Hardy-Weinberg pelo chi-quadrado (x2). As variáveis coletadas foram cruzadas com o desfecho de DAC através do chi-quadrado com Odds Ratio (OR) e intervalo de confiança (IC) de 95%.

As variáveis que se mostraram significativas foram submetidas ao ajuste por uma regressão logística binária ainda com a DAC como desfecho e IC 95%.

Todos os dados coletados foram tratados com o programa SPSS(©) versão 25, IBM(©)Corp., Nova York, NY.

Resultados

A Tabela 1 mostra a relação entre as variáveis estudadas e a DAC. Foi possível avaliar que a idade categorizada no ponto de corte da média de todos os participantes, 60 anos (p = 0,035), o gênero masculino (p = 0,012) e os pacientes que apresentavam periodontite (p = 0,013) estiveram estatisticamente relacionados à presença de DAC.

Tabela 1 Variáveis analisadas pelo chi-quadrado com desfecho a doença arterial coronariana (DAC) 

Variáveis analisadas DAC (n = 80) OR IC 95% p
Presença (%) Ausência (%) Mín. Máx.
Idade ≥ 60 anos 31 (59,6) 10 (35,7) 2,65 1,02 6,87 0,04
≤ 59 anos 21 (40,4) 18 (64,3)
Gênero Masculino 32 (61,5) 9 (32,1) 3,37 1,28 8,9 0,01
Feminino 20 (38,5) 19 (67,9)
Sobrepeso e obesidade IMC ≥ 25 30 (57,7) 22 (78,6) 2,68 0,93 7,73 0,35
IMC ≤ 24 22 (42,3) 6 (21,4)
Raça Branca 45 (86,5) 22 (78,6) 1,75 0,52 5,84 0,06
Não branca 7 (13,5) 6 (21,4)
Periodontite Presença 26 (50%) 6 (21,4) 3,66 1,27 10,5 0,01
Ausência 26 (50%) 22 (78,6)
PCR +1444 C > TRS 1130864 Com alelo T 43 (82,7) 12 (42,9) 6,37 2,25 17,9 0,001
Sem alelo T 9 (17,3) 16 (57,1)
IL-6-174 G > CRS 1800795 Com alelo C 30 (57,7) 9 (32,1) 2,87 1,09 7,55 0,029
Sem alelo C 22 (42,3) 19 (67,9)

Fonte: autoria própria.

OR: razão de chances; IC: intervalo de confiança; significativo quando o intervalo não contiver a unidade; p: valor significativo < 0,05.

Os pacientes portadores do polimorfismo da PCR +1444 C > T, com presença do alelo de risco T (p = 0,001), bem como os portadores do polimorfismo da IL-6 -174 G > C, alelo de risco C (p = 0,025), foram associados à DAC.

Na sequência foi realizada avaliação de regressão logística binária na qual foram carregadas todas as variáveis independentes significativas nas análises bivariadas de maneira direta com o objetivo de verificar quais delas seriam previsoras da variável dependente de DAC.

O resultado deste ajuste (Tabela 2) demonstrou que continuaram relacionadas à DAC idade maior que 60 anos (p = 0,029) e polimorfismo da PCR +1444 C > T (p = 0,014).

Tabela 2 Variáveis ajustadas pela regressão logística 

Variáveis analisadas Chi-quadrado Regressão logística
p OR IC 95% p OR IC 95%
Máx. Máx.
Idade ≥ 60 anos 0,04 2,65 1,02 6,87 0,02 3,6 1,14 11,3
Gênero masculino 0,01 3,37 1,28 8,91 0,37 1,71 0,51 5,67
Periodontite 0,01 3,66 1,27 10,5 0,16 2,47 0,68 8,9
Polimorfismo PCR +1444 0,001 6,37 2,25 17,9 0,014 4,31 1,34 13,8
Polimorfismo IL-6 -174 0,029 2,87 1,09 7,55 0,06 2,94 0,94 9,19

Fonte: autoria própria.

p: valor significativo < 0,05; OR: razão de chances; IC: intervalo de confiança; significativo quando o intervalo não contiver a unidade.

Discussão

Periodontite é uma doença inflamatória crônica, multifatorial, resultante de uma série de processos de disbiose, ativando a produção de proteínas e citocinas pró-inflamatórias e processos de sinalização. Por estes motivos, segundo estudos epidemiológicos, intervencionais e funcionais recentes, estabelecem um nexo causal com o desenvolvimento da DAC.10-12,16

A idade dicotomizada maior de 60 anos e o gênero masculino foram associados estatisticamente a maiores chances de apresentar também a DAC. É notório que a idade e o gênero masculino sejam fatores de risco já conhecidos da doença coronariana e da periodontite,23 tanto que muitos estudos realizam o ajuste para estes fatores quando analisam apenas a aterosclerose, porém na relação entre periodontite e DAC com influência de outras covariáveis independentes, optou-se por mantê-las com vistas a ajustes de contribuição nos modelos de regressão logística.

A periodontite, na análise bivariada, mostrou-se associada significativamente com a DAC (p = 0,013; OR 3,66; IC 95% [1,27-10,5]). Esta relação vem sendo pesquisada por décadas. Estudo transversal com 60.174 participantes analisou a relação entre periodontite e DAC e encontrou relação estatística significativa entre as duas condições com OR de 1,59 e IC 95%, entre 1,31 e 1,81, após o ajuste para os fatores de confusão.23

Neste estudo verificou-se a associação de polimorfismos ligados à inflamação periodontal (IL-6 e PCR) e sua possível associação a DAC. Observamos forte associação (p = 0,001) entre a presença do polimorfismo da PCR +1444 C > T, alelo de risco T e o grupo-caso com OR 6,37; IC 95% (2,25-17,9), o que contradiz autores que analisaram cinco estudos, totalizando 18.637 participantes, nos quais o polimorfismo da PCR +1444 C > T foi ajustado para os fatores de confusão e comparados com a presença da DAC, e não encontraram associação entre este polimorfismo e a doença coronariana.24 É possível inferir que esta relação possa advir dos níveis séricos da PCR mantidos pela periodontite crônica ao longo de vários anos.

Esta relação é corroborada por estudos que compararam o tamanho das placas ateroscleróticas e o polimorfismo da PCR +1444 C > T em 196 pacientes com DAC provenientes de um banco de dados de estudos que avaliaram o uso de nitratos (ENCORE) na Suíça, concluindo que os portadores deste polimorfismo, foram ligados independentemente a volumes de placa maiores.15

Estes resultados nos levam a crer que, de alguma forma, este tipo de polimorfismo atue diretamente no processo aterosclerótico, provavelmente através dos níveis séricos de PCR, como indicam recentes estudos.25,26

O polimorfismo da IL-6 -174 G > C mostrou-se estatisticamente relacionado com a DAC (p = 0,025; OR 2,87; IC 95% [1,09-7,55]). Estes achados estão de acordo com autores que investigaram a relação deste polimorfismo com o risco de DAC em 484 chineses e encontraram que o polimorfismo da IL-6 -174 G > C foi positivamente associado ao risco de DAC (p = 0,001; OR 2,18; IC 95% [1,26-3,77]), de acordo com nossos achados, porém com significância estatística maior.18

Em contrapartida, em estudo recente, foram analisados 280 pacientes em uma população do norte da Índia para cinco tipos de polimorfismos, dentre eles o IL-6 -174 G > C. Nesta análise, os autores não encontraram significância estatística entre polimorfismo e DAC.20 Da mesma forma, autores brasileiros analisaram 200 pacientes com síndrome coronariana aguda e sua relação com o polimorfismo da IL-6 -174 G > C em Pernambuco, Brasil, não encontrando relação significativa entre os alelos de risco e a síndrome coronariana aguda.27

As variáveis que se mostraram significativas foram incluídas em um modelo de regressão logística bivariada com vistas a ajustar a independência dessas associações, verificando quais seriam preditoras de DAC. O modelo mais uniforme foi o que manteve independentemente associadas à DAC a idade maior que 60 anos e a presença do polimorfismo da PCR +1444 C > T (Tabela 2).

Considerando a limitação do tipo de estudo (caso-controle), em que a informação sobre a exposição ou o fator é obtida após a ocorrência da doença, não havendo como distinguir a cronologia entre essa exposição e o aparecimento da doença, determinar uma relação de casualidade direta entre a periodontite e a DAC torna-se mais difícil. O fato desta associação estar presente pode indicar tratamentos preventivos e curativos para controle da periodontite com o objetivo de tentar diminuir o conjunto de fatores que contribuem para a formação e o desenvolvimento da DAC, além dos fatores de risco já conhecidos.

Conclusões

Com base nos dados obtidos, pode-se concluir que a idade maior que 60 anos e a presença do polimorfismo da PCR +1444 C > T foram preditores independentes associados à DAC.

A periodontite e o gênero masculino não se mantiveram associados à DAC após o ajuste pela regressão logística.

REFERÊNCIAS

1 Bartova J, Sommerova P, Lyuya-Mi Y, Mysak J, Prochazkova J, Duskova J et al. Periodontitis as a risk factor of atherosclerosis. J Immunol Res. 2014;2014:636893.
2 Hajishengallis G. Periodontitis: from microbial immune subversion to systemic inflammation. Nat Rev Immunol. 2015;15(1):30-44.
3 Hansen GM, Egeberg A, Holmstrup P, Hansen PR. Relation of periodontitis to risk of cardiovascular and all-cause mortality (from a Danish Nationwide Cohort Study). Am J Cardiol. 2016;118(4):489-93.
4 Kholy KE, Genco RJ, van Dyke TE. Oral infections and cardiovascular disease. Trends Endocrinol Metab. 2015;26(6):315-21.
5 Harvey JD. Periodontal microbiology. Dent Clin North Am. 2017;61(2):253-69.
6 Huck O, Saadi-Thiers K, Tenenbaum H, Davideau JL, Romagna C, Laurent Y et al. Evaluating periodontal risk for patients at risk of or suffering from atherosclerosis: recent biological hypotheses and therapeutic consequences. Arch Cardiovasc Dis. 2011;104(5):352-8.
7 Wolf D, Stachon P, Bode C, Zirlik A. Inflammatory mechanisms in atherosclerosis. Hamostaseologie. 2014;34(1):63-71.
8 Boudoulas KD, Triposciadis F, Geleris P, Boudoulas H. Coronary atherosclerosis: pathophysiologic basis for diagnosis and management. Prog Cardiovasc Dis. 2016;58(6):676-92.
9 Taleb S. Inflammation in atherosclerosis. Arch Cardiovasc Dis. 2016; 109(12):708-15.
10 Tabeta K, Yoshie H, Yamazaki K. Current evidence and biological plausibility linking periodontitis to atherosclerotic cardiovascular disease. Jpn Dent Sci Rev. 2014;50(3):55-62.
11 Nguyen CM, Kim JW, Quan VH, Nguyen BH, Tran SD. Periodontal associations in cardiovascular diseases: the latest evidence and understanding. J Oral Biol Craniofac Res. 2015;5(3):203-6.
12 Chistiakov DA, Orekhov AN, Bobryshev YV. Links between atherosclerotic and periodontal disease. Exp Mol Pathol. 2016;100(1):220-35.
13 Slocum C, Kramer C, Genco CA. Immune dysregulation mediated by the oral microbiome: potential link to chronic inflammation and atherosclerosis. J Intern Med. 2016;280(1):114-28.
14 Almeida APCPSC, Fagundes NCF, Maia LC, Lima RR. Is there an association between periodontitis and atherosclerosis in adults? a systematic review. Curr Vasc Pharmacol. 2018;16(6):569-82.
15 Hermann M, Fischer D, Hoffmann MM, Gasser T, Quitzau K, Meinertz T et al. CRP and CD14 polymorphisms correlate with coronary plaque volume in patients with coronary artery disease--IVUS substudy of the ENCORE trials. Atherosclerosis. 2012;220(1):172-6.
16 Zanella SM, Souza LV, Suzigan BH, Saba-Chujfi E, Barbisan JN. The association between oral health and atherosclerotic coronary artery disease in patients submitted to coronary angiography: a controlled cross-sectional study. Rev Bras Cardiol Invasiva. 2012;20(2):178-83.
17 Lima-Neto LG, Hirata RD, Luchessi AD, Silbiger VN, Stephano MA, Sampaio MF et al. CD14 and IL6 polymorphisms are associated with a pro-atherogenic profile in young adults with acute myocardial infarction. J Thromb Thrombolysis. 2013;36(3):332-40.
18 Mao L, Geng GY, Han WJ, Zhao MH, Wu L, Liu HL. Interleukin-6 (IL-6) -174G/C genomic polymorphism contribution to the risk of coronary artery disease in a Chinese population. Genet Mol Res. 2016;15(2).
19 Aarabi G, Heydecke G, Seedorf U. Roles of oral infections in the pathomechanism of atherosclerosis. Int J Mol Sci. 2018;19(7):pii:E1978.
20 Mastana S, Prakash S, Akam EC, Kirby M, Lindley MR, Sinha N et al. Genetic association of pro-inflammatory cytokine gene polymorphisms with coronary artery disease (CAD) in a North Indian population. Gene. 2017 Sept 10; 628:301-7.
21 Brasil. Ministério da Saúde. SB Brasil 2010: Pesquisa Nacional de Saúde Bucal: resultados principais [internet]. Brasília: Ministério da Saúde; 2012. [acesso em 18 out 2019]. Disponível em: .
22 Trevilatto PC, Scarel-Caminaga RM, de Brito Jr. RB, de Souza AP, Line SR. Polymorphism at position -174 of IL-6 gene is associated with susceptibility to chronic periodontitis in a Caucasian Brazilian population. J Clin Periodontol. 2003;30(5):438-42.
23 Beukers NG, van der Heijden GJ, van Wijk AJ, Loos BG. Periodontitis is an independent risk indicator for atherosclerotic cardiovascular diseases among 60,174 participants in a large dental school in the Netherlands. J Epidemiol Community Health. 2017;71(1):37-42.
24 Lawlor DA, Harbord RM, Timpson NJ, Lowe GD, Rumley A, Gaunt TR et al. The association of C-reactive protein and CRP genotype with coronary heart disease: findings from five studies with 4,610 cases among 18,637 participants. PLoS One. 2008;3(8):e3011.
25 Tibaut M, Caprnda M, Kubatka P, Sinkoviĉ A, Valentova V, Filipova S et al. Markers of atheosclerosis: part 1 - serological markers. Heart, Lung Circ. 2018;28(5):667-77.
26 Sakata K, Gamou T, Tada H, Hayashi K, Ino H, Yamagishi M, et al. Low baseline high-sensitive C-reactive protein is associated with coronary atherosclerosis regression: insights from the MILLION study. J Atheroscler Thromb. 2019;26(5):442-51.
27 Carvalho VCV, Silva LCA, Werkhauser RP, Montenegro ST, Silva CGR, Gomes AV, et al. Evaluation of IL-6 (-174 G/C) Polymorphism in Acute Coronary Syndrome in the Northeast of Brazil. Int J Cardiovasc Sci. 2016;29(4):288-94.
Política de Privacidade. © Copyright, Todos os direitos reservados.